Lated from Title Loaded From File placentas using Trizol reagent (Invitrogen, San Diego, CA), and cDNA was synthesized with Moloney murine leukaemia virus reverse transcriptase and an oligo-d (T)15 primer (Promega, Madison, WI). A target cDNA sample was added to SYBR Green PCR master mix (Applied Biosystems, Foster city, CA) to generate quantitative gene expression data on an ABI Prism 7300 sequence detection system (Applied Biosystems). An amplification reaction was performed in a total volume of 20 mL for 40 cycles. All samples were run in triplicate and the relative expression levels were determined by normalization to b-actin and presented as fold increase or decrease relative to the controls. Primer sequences used were as follows: b-actin, forward: GCTCTGGCTCCT AGCACCAT; reverse: GATCCACACAGAGTACTTGCGC. Foxp3, forward: GGCCCTTCTCCAGGACAGA; reverse: GCTGAT CATGGCTGGGTTGT [26]. Caspase 3, forward: TCTGACTGGAAAGCCGAAACT; reverse: AGGGAC TGGATGAACCACGAC [27].T. gondii and ESA PreparationT. gondii RH strain tachyzoites were maintained in mice by intraperitoneal inoculation every 3 days [23]. T. gondii ESA was prepared according to GE et al [17]. The T. gondii ESA was treated by AffinityPak Detoxi-Gel Endotoxin Removing Gel (Thermo, fairlawn, OH, USA) to remove endotoxin. The endotoxin of T. gondii ESA was 0.01 EU/kg, and lower than 0.2 EU/kg according to the endotoxin normative standard in `American FDA finally product examination guide’ [24]. Then the ESA was dissolved in PBS. The protein concentration of ESA was 0.933 mg/ml, as determined by bicinchoninic acid protein assay (Pierce, Rockford, IL). The same batch of ESA prepared was used throughout the study. A total of 0.1 ml of ESA was injected intraperitoneally (ip) into pregnant mice at gestational day 5 (G5), day 10 (G10) and day 15 (G15), respectively. The injection of same volume of PBS was as control.Western Blot AnalysisCD4+CD25+ T cells and placentas were washed in PBS, then lysed in lysis buffer (25 mM Tris, pH 8.5, 2 lithium dodecyl sulfate, 1 mM EDTA, 10 mM sodium fluoride, 1 mM sodium orthovanadate, and 16complete protease inhibitors) and quantified by bicinchoninic acid protein assay (Pierce, Rockford, IL). Lysates were separated on 4?5 SDS olyacrylamide gel electrophoresis (PAGE) gels and transferred to PVDF (IPVH00010, Millipore, USA) followed by blocking in TBS/ 0.1 Tween 20 with 5 non-fat dry milk. Rabbit anti-mouse Foxp3 antibody (1:2000) (Abcam, Cambridge, MA), Bax antibody (1:1000), Bcl-2 antibody (1:1000), Caspase 3 antibody(1:1000) and goat anti-rabbit IgG HRP-conjugated antibody (1:3000) (all manufactured by Cell Signaling Technology) were used for the detection of proteins. Glyceraldehyde-3- phosphate dehydrogenase (GAPDH) or b-actin was detected with mouse anti-GAPDH antibody (1:1000) or anti-b-actin antibody (1:5000) (both manufactured by Epitomics) as an internal control.Flow Cytometric AnalysisAfter the injection of T. gondii ESA or PBS at G5, G10 and G15, respectively, mice were sacrificed at G18. Spleens, inguinal lymph nodes and peripheral blood from the mice were collected, and Title Loaded From File single-cell suspensions were prepared according to Tang et al [25]. For 23977191 the analysis of CD4+CD25+Foxp3+ T-cell, the Mouse Regulatory T Cell Staining Kit was used following the instructions of the manufacturer (eBioscience, San Diego, CA, USA). For the analysis of apoptosis, cells (106) were stained with anti-CD4 EImmunohistochemistryImmediately following euthanasia of pregnant mice, placentas were.Lated from placentas using Trizol reagent (Invitrogen, San Diego, CA), and cDNA was synthesized with Moloney murine leukaemia virus reverse transcriptase and an oligo-d (T)15 primer (Promega, Madison, WI). A target cDNA sample was added to SYBR Green PCR master mix (Applied Biosystems, Foster city, CA) to generate quantitative gene expression data on an ABI Prism 7300 sequence detection system (Applied Biosystems). An amplification reaction was performed in a total volume of 20 mL for 40 cycles. All samples were run in triplicate and the relative expression levels were determined by normalization to b-actin and presented as fold increase or decrease relative to the controls. Primer sequences used were as follows: b-actin, forward: GCTCTGGCTCCT AGCACCAT; reverse: GATCCACACAGAGTACTTGCGC. Foxp3, forward: GGCCCTTCTCCAGGACAGA; reverse: GCTGAT CATGGCTGGGTTGT [26]. Caspase 3, forward: TCTGACTGGAAAGCCGAAACT; reverse: AGGGAC TGGATGAACCACGAC [27].T. gondii and ESA PreparationT. gondii RH strain tachyzoites were maintained in mice by intraperitoneal inoculation every 3 days [23]. T. gondii ESA was prepared according to GE et al [17]. The T. gondii ESA was treated by AffinityPak Detoxi-Gel Endotoxin Removing Gel (Thermo, fairlawn, OH, USA) to remove endotoxin. The endotoxin of T. gondii ESA was 0.01 EU/kg, and lower than 0.2 EU/kg according to the endotoxin normative standard in `American FDA finally product examination guide’ [24]. Then the ESA was dissolved in PBS. The protein concentration of ESA was 0.933 mg/ml, as determined by bicinchoninic acid protein assay (Pierce, Rockford, IL). The same batch of ESA prepared was used throughout the study. A total of 0.1 ml of ESA was injected intraperitoneally (ip) into pregnant mice at gestational day 5 (G5), day 10 (G10) and day 15 (G15), respectively. The injection of same volume of PBS was as control.Western Blot AnalysisCD4+CD25+ T cells and placentas were washed in PBS, then lysed in lysis buffer (25 mM Tris, pH 8.5, 2 lithium dodecyl sulfate, 1 mM EDTA, 10 mM sodium fluoride, 1 mM sodium orthovanadate, and 16complete protease inhibitors) and quantified by bicinchoninic acid protein assay (Pierce, Rockford, IL). Lysates were separated on 4?5 SDS olyacrylamide gel electrophoresis (PAGE) gels and transferred to PVDF (IPVH00010, Millipore, USA) followed by blocking in TBS/ 0.1 Tween 20 with 5 non-fat dry milk. Rabbit anti-mouse Foxp3 antibody (1:2000) (Abcam, Cambridge, MA), Bax antibody (1:1000), Bcl-2 antibody (1:1000), Caspase 3 antibody(1:1000) and goat anti-rabbit IgG HRP-conjugated antibody (1:3000) (all manufactured by Cell Signaling Technology) were used for the detection of proteins. Glyceraldehyde-3- phosphate dehydrogenase (GAPDH) or b-actin was detected with mouse anti-GAPDH antibody (1:1000) or anti-b-actin antibody (1:5000) (both manufactured by Epitomics) as an internal control.Flow Cytometric AnalysisAfter the injection of T. gondii ESA or PBS at G5, G10 and G15, respectively, mice were sacrificed at G18. Spleens, inguinal lymph nodes and peripheral blood from the mice were collected, and single-cell suspensions were prepared according to Tang et al [25]. For 23977191 the analysis of CD4+CD25+Foxp3+ T-cell, the Mouse Regulatory T Cell Staining Kit was used following the instructions of the manufacturer (eBioscience, San Diego, CA, USA). For the analysis of apoptosis, cells (106) were stained with anti-CD4 EImmunohistochemistryImmediately following euthanasia of pregnant mice, placentas were.