Recombinant Human GALNT2 Protein (His Tag)
Name : Recombinant Human GALNT2 Protein (His Tag)Biological Activity : Background : GALNT2, also known as GalNAc-T2, is a member of the GalNAc-transferases family. Members of this family transfer an…
Name : Recombinant Human GALNT2 Protein (His Tag)Biological Activity : Background : GALNT2, also known as GalNAc-T2, is a member of the GalNAc-transferases family. Members of this family transfer an…
Name : Recombinant Human GALNT10 Protein (His Tag)Biological Activity : Background : Ectopic expression and knockdown studies showed that GALNT10 indeed promotes proliferation and apoptosis resistance of hepatoma cells in…
Name : Recombinant Human GALK1 Protein (His & GST Tag)Biological Activity : Background : Galactokinase, also known as Galactose kinase, GALK and GALK1, is a protein which belongs to theGHMP…
Name : Recombinant Human Galectin-9/LGALS9 Protein (hFc Tag)Biological Activity : Background : LGALS9 (Galectin 9) is a Protein Coding gene. 6 alternatively spliced human isoforms have been reported. The galectins…
Name : Recombinant Human Galectin-8/LGALS8 ProteinBiological Activity : Background : Biological Activity : Measured by its ability to agglutinate human red blood cells. The ED50 for this effect is typically…
Name : Recombinant Human Galectin-8/LGALS8 Protein (GST Tag)Biological Activity : Background : Biological Activity : Measured by its ability to agglutinate human red blood cells. The ED50 for this effect…
Name : Recombinant Human Galectin-7/LGALS7 Protein (GST Tag)Biological Activity : Background : LGALS7, also known as Galectin-7, is a member of the galectins family. The galectins are a family of…
Name : Recombinant Canine SDF-1/CXCL12 ProteinBiological Activity : Background : The human stromal cell-derived factor-1 (SDF1), also known as CXCL12, is a small (8 kDa) cytokine highly conserved chemotactic cytokine…
Name : Recombinant Human Galectin-7/LGALS7 Protein (His Tag)Biological Activity : Background : LGALS7, also known as Galectin-7, is a member of the galectins family. The galectins are a family of…
Name : Recombinant Human Galectin-3/LGALS3 Protein, Low EndotoxinBiological Activity : Background : LGALS3 (Galectin 3) is a Protein Coding gene. This gene encodes a member of the galectin family of…
Name : Recombinant Human Galectin-3/LGALS3 ProteinBiological Activity : Background : LGALS3 (Galectin 3) is a Protein Coding gene. This gene encodes a member of the galectin family of carbohydrate-binding proteins.…
Name : Recombinant Human Galectin-3/LGALS3 Protein (GST Tag), HPLC-verifiedBiological Activity : Background : LGALS3 (Galectin 3) is a Protein Coding gene. This gene encodes a member of the galectin family…
Name : Recombinant Human Galectin-3/LGALS3 Protein (His Tag)Biological Activity : Background : LGALS3 (Galectin 3) is a Protein Coding gene. This gene encodes a member of the galectin family of…
Name : Recombinant Human Galectin-1/LGALS1 ProteinBiological Activity : Background : Galectin-1 (Gal-1, GAL1), is a member of the galectins, a family of animal lectins ranging from Caenorhabditis elegans to humans,…
Name : Recombinant Human Galectin-1/LGALS1 Protein (His Tag)Biological Activity : Background : Galectin-1 (Gal-1, GAL1), is a member of the galectins, a family of animal lectins ranging from Caenorhabditis elegans…
Name : Recombinant Human GALE Protein (His Tag)Biological Activity : Background : UDP galactose-4'-epimerase, also known as GALE, enables the body to process a simple sugar called galactose, which is…
Name : Recombinant Human Galanin Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : P22466NCBI…
Name : Recombinant Human GADD45G ProteinBiological Activity : Background : GADD45G, also known as CR6, is part of the nuclear proteins to interact with various proteins whose transcript levels are…
Name : Recombinant Canine RBP4 Protein (His Tag)Biological Activity : Background : Retinol-binding protein 4 (RBP4) is the specific carrier for retinol (also known as vitamin A), and is responsible…
Name : SARS-CoV-2 (2019-nCoV) Spike S2 ECD-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the…
Name : Recombinant Human GADD45A Protein (His & GST Tag)Biological Activity : Background : GADD45A is a member of the GADD45 Family, and has been found to associate with several…
Name : Recombinant Human GAD67 Protein (His Tag)Biological Activity : Background : Glutamate decarboxylase 1, also known as 67 kDa glutamic acid decarboxylase, Glutamate decarboxylase 67 kDa isoform and GAD1,…
Name : Recombinant Human GAD65/GAD2 Protein (GST Tag)Biological Activity : Background : Glutamate decarboxylase 2, also known as glutamate decarboxylase 65 kDa isoform, 65 kDa glutamic acid decarboxylase, GAD2 and…
Name : Recombinant Human GABARAPL2 Protein (His Tag)Biological Activity : Background : GATE-16, also known as ATG8, belongs to the MAP1 LC3 family. It is expressed at high levels in…
Name : Recombinant Human GABARAPL1 Protein (His Tag)Biological Activity : Background : ATG8, also known as GABARAPL1, is a ubiquitin-like protein that has a crystal structure. ATG8 consists of a…
Name : Recombinant Human GABARAP Protein (His & MBP Tag)Biological Activity : Background : The Atg8/LC3/GABARAP family of proteins, a group that has structural homology with ubiquitin, connects with a…
Name : Recombinant Human G6B Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_612116.1NCBI…
Name : Recombinant Human G6B Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_612116.1NCBI…
Name : Recombinant Human G-CSF Protein (Isoform b), HPLC-verifiedBiological Activity : Background : Granulocyte-colony stimulating factor (G-CSF) is a growth factor and an essential cytokine belonging to the CSF family…
Name : Recombinant Human G-CSF Protein (hFc Tag)Biological Activity : Background : Granulocyte-colony stimulating factor (G-CSF) is a growth factor and an essential cytokine belonging to the CSF family of…
Name : Recombinant Canine RBP4 Protein (hFc Tag)Biological Activity : Background : Retinol-binding protein 4 (RBP4) is the specific carrier for retinol (also known as vitamin A), and is responsible…
Name : Recombinant Human FZD3/frizzled 3 Protein (ECD, His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant Human FUT8 Protein (aa 68-575, His Tag), HPLC-verifiedBiological Activity : Background : Alpha (1,6) fucosyltransferase 8, also known as FUT8, is a member of the glycosyltransferase family.…
Name : Recombinant Human FUT10 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : Q6P4F1-1NCBI…
Name : Recombinant Human Fucose Mutarotase Protein (His Tag)Biological Activity : Background : FUOM, also known as fucose mutarotase and FucM, belongs to the RbsD / FucU family. FUOM is…
Name : Recombinant Human FUCA1 Protein (His Tag)Biological Activity : Background : FUCA1 is a lysosomal enzyme involved in the degradation of fucose-containing glycoproteins and glycolipids. Mutations in FUCA1 gene…
Name : Recombinant Human Ferritin heavy chain 1/FTH1 ProteinBiological Activity : Background : FTH1 (ferritin, heavy polypeptide 1) is the heavy subunit of ferritin which is the major intracellular iron…
Name : Recombinant Human FTCD Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No. : NP_006648.1NCBI…
Name : Recombinant Human FSTL5 Protein (His Tag)Biological Activity : Background : FSTL5 may have molecular function (calcium ion binding) and to localize in various compartments (cytoplasm, extracellular space, extracellular…
Name : Recombinant Human FSTL5 Protein (hFc Tag)Biological Activity : Background : FSTL5 may have molecular function (calcium ion binding) and to localize in various compartments (cytoplasm, extracellular space, extracellular…
Name : Recombinant Human Follistatin-like 1/FSTL1 Protein (His Tag)Biological Activity : Background : Follistatin-related protein 1 (FSTL1) is an extracellular glycoprotein whose functional significance in physiological and pathological processes is…
Name : Recombinant Canine PDGF-A Protein (His Tag)Biological Activity : Background : Platelet-derived growth factor alpha (PDGFA) is frequently upregulated in various cancers and thought to function as a key…
Name : Recombinant Human FSH Beta Protein (His Tag)Biological Activity : Background : Follicle-stimulating hormone (FSH) is a gonadotrope-derived heterodimeric glycoprotein. FSH plays an essential role in processes involved in…
Name : Recombinant Human FSH Beta Protein (hFc Tag)Biological Activity : Background : Follicle-stimulating hormone (FSH) is a gonadotrope-derived heterodimeric glycoprotein. FSH plays an essential role in processes involved in…
Name : Recombinant Human FSH alpha & FSH beta Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein…
Name : Recombinant Human FRZB Protein (His Tag)Biological Activity : Background : FRZB also known as sFRP-3, is a secreted protein containing a domain similar to the putative Wnt-binding region…
Name : Recombinant Human Frizzled 6 Protein (His Tag)Biological Activity : Background : FZD6 plays a pivotal role in the growth and guidance of the nail plate in humans by…
Name : Recombinant Human Frizzled 6 Protein (mFc Tag)Biological Activity : Background : FZD6 plays a pivotal role in the growth and guidance of the nail plate in humans by…
Name : Recombinant Human Frizzled-5 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Wnt signaling is involved in a variety of embryonic development processes of nonvertebrates and vertebrates, where it…
Name : Recombinant Human Frizzled-5 Protein (ECD, hFc Tag)Biological Activity : Background : Wnt signaling is involved in a variety of embryonic development processes of nonvertebrates and vertebrates, where it…
Name : Recombinant Human Frizzled-4 Protein (His Tag)Biological Activity : Background : Familial exudative vitreoretinopathy (FEVR) is a hereditary blinding disorder that features defects in retinal vascular development. Mutations in…
Name : Recombinant Human Frizzled-4 Protein (hFc Tag)Biological Activity : Background : Familial exudative vitreoretinopathy (FEVR) is a hereditary blinding disorder that features defects in retinal vascular development. Mutations in…
Name : Recombinant Canine PDGF-A Protein (hFc Tag)Biological Activity : Background : Platelet-derived growth factor alpha (PDGFA) is frequently upregulated in various cancers and thought to function as a key…
Name : Recombinant Human Frizzled-10 Protein (His Tag)Biological Activity : Background : Frizzled-1, also known as Fz-1, CD35 and FZD1, is a multi-pass membrane protein which belongs to theG-protein coupled…
Name : Recombinant Human Frizzled-10 Protein (hFc Tag)Biological Activity : Background : Frizzled-1, also known as Fz-1, CD35 and FZD1, is a multi-pass membrane protein which belongs to theG-protein coupled…
Name : Recombinant Human Fragilis/IFITM3 Protein (mFc Tag)Biological Activity : Background : Interferon-induced transmembrane protein 3 (IFITM3) belongs to the CD225 family. To replicate, viruses must gain access to the…
Name : Recombinant Human Fractalkine/CX3CL1 Protein (His Tag)Biological Activity : Background : Fractalkine or Chemokine (C-X3-C motif) ligand 1 (CX3CL1) is a member of the CX3C chemokine family. Fractalkine /…
Name : Recombinant Human FOLR2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Folate receptor beta, also known as Folate receptor 2, FBP, and FOLR2, is a member of the…
Name : Recombinant Human FOLR1 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The protein encoded by FOLR1 gene is a member of the folate receptor…
Name : Recombinant Human FOLR1 Protein (ECD, hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The protein encoded by FOLR1 gene is a member of the folate receptor…
Name : Recombinant Human FOLR1 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : The protein encoded by FOLR1 gene is a member of the folate receptor family. Members of…
Name : Recombinant Human Follistatin Protein (His Tag)Biological Activity : Background : Follistatin is a single-chain gonadal protein that specifically inhibits follicle-stimulating hormone release. The single FST gene encodes two…
Name : Recombinant Human Follistatin Protein (His Tag)Biological Activity : Background : Follistatin is a single-chain gonadal protein that specifically inhibits follicle-stimulating hormone release. The single FST gene encodes two…
Name : Recombinant Canine PDGF-B Protein (His Tag)Biological Activity : Background : Platelet-derived growth factor-B (PDGFB) is necessary for normal cardiovascular development. The administration of PDGFB alone normalized tumor vasculature…
Name : Recombinant Human Follistatin Protein (hFc Tag)Biological Activity : Background : Follistatin is a single-chain gonadal protein that specifically inhibits follicle-stimulating hormone release. The single FST gene encodes two…
Name : Recombinant Human FNDC4 Protein (ECD, mFc Tag)Biological Activity : Background : FNDC4 acts as an anti-inflammatory factor on macrophages and improves mouse model of induced colitis. FNDC4 could…
Name : Recombinant Human Flt3 Ligand/FLT3LG Protein, HPLC-verifiedBiological Activity : Background : FLT3L, also known as flt3 ligand, is a small molecule that acts as a growth factor that increases…
Name : Recombinant Human Flt3 Ligand/FLT3LG Protein (His Tag), HPLC-verifiedBiological Activity : Background : FLT3L, also known as flt3 ligand, is a small molecule that acts as a growth factor…
Name : Recombinant Human FLT3 Protein (ECD, hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in…
Name : Recombinant Human FLT3 Protein (T227M, ECD, His Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different…
Name : Recombinant Human FLT3 Protein (ECD, hFc Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Mouse VEGFR1/FLT1 Protein (ECD, His Tag)Biological Activity : Background : Vascular endothelial growth factor receptor 1, also known as VEGFR-1, Fms-like tyrosine kinase 1, Tyrosine-protein kinase FRT,…
Name : Recombinant Human VEGFR1/FLT1 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Vascular endothelial growth factor receptor 1, also known as VEGFR-1, Fms-like tyrosine kinase…
Name : Recombinant Human VEGFR1/FLT1 Protein (His Tag)Biological Activity : Background : Vascular endothelial growth factor receptor 1, also known as VEGFR-1, Fms-like tyrosine kinase 1, Tyrosine-protein kinase FRT, Tyrosine-protein…
Name : Recombinant Canine PD-L1/B7-H1 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Programmed death-1 ligand-1 (PD-L1, CD274, B7-H1) has been identified as the ligand for the immunoinhibitory receptor…
Name : Recombinant Human VEGFR1/FLT1 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Vascular endothelial growth factor receptor 1, also known as VEGFR-1, Fms-like tyrosine kinase 1, Tyrosine-protein kinase…
Name : Recombinant Human VEGFR1/FLT1 Protein (hFc Tag)Biological Activity : Background : Vascular endothelial growth factor receptor 1, also known as VEGFR-1, Fms-like tyrosine kinase 1, Tyrosine-protein kinase FRT, Tyrosine-protein…
Name : Recombinant Human FLRT3 Protein (His Tag)Biological Activity : Background : Leucine-rich repeat transmembrane protein FLRT3, also known as Fibronectin-like domain-containing leucine-rich transmembrane protein 3, and FLRT3, is a…
Name : Recombinant Human FLRT2 Protein (His Tag)Biological Activity : Background : Fibronectin Leucine-Rich Transmembrane (FLRT) proteins are glycosylated membrane proteins expressed at the cell surface which localise in a…
Name : Recombinant Human FLRT1 Protein (His Tag)Biological Activity : Background : The three fibronectin leucine-rich repeat transmembrane (FLRT) proteins contain 10 leucine-rich repeats (LRR), a type III fibronectin (FN)…
Name : Recombinant Human FKBP7 Protein (His Tag)Biological Activity : Background : PPIase is a member of the immunophilin protein family. It also belongs to the cyclophilin-type PPIase family, PPIL3…
Name : Recombinant Human FKBP7 Protein (hFc Tag)Biological Activity : Background : PPIase is a member of the immunophilin protein family. It also belongs to the cyclophilin-type PPIase family, PPIL3…
Name : Recombinant Human FKBP25/FKBP3 Protein (GST Tag)Biological Activity : Background : FKBP3 is a member of FK506-binding proteins (FKBPs). miR-145-5p overexpression suppressed cell proliferation of NSCLC cells which was…
Name : Recombinant Human FKBP14 Protein (His Tag)Biological Activity : Background : FKBP14 belongs to the FK506-binding protein family. It contains 2 EF-hand domains and one PPIase FKBP-type domain. FKBP14…
Name : Recombinant Human FKBP12 Protein (His Tag)Biological Activity : Background : FK506 binding protein 12 (FKBP12), also known as FKBP1, along with cyclophilin, are two major members of the…
Name : Recombinant Canine PD-L1/B7-H1 Protein (hFc Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Programmed death-1 ligand-1 (PD-L1, CD274, B7-H1) has been identified as the ligand for the immunoinhibitory receptor…
Name : Recombinant Human FKBP11 Protein (mFc Tag)Biological Activity : Background : FKBP11 serve as biomarker and/or therapeutic target for Acute aortic dissection (AAD). FKBP11 during the development of HCC…
Name : Recombinant Human ficolin 1/FCN1 Protein (His Tag)Biological Activity : Background : Ficolins are humoral molecules of the innate immune systems which recognize carbohydrate molecules on pathogens, apoptotic and…
Name : Recombinant Human Fibronectin Protein (His Tag)Biological Activity : Background : Fibronectin (FN) is a glycoprotein component of the extracellular matrix of the extracellular matrix (ECM) with roles in…
Name : Recombinant Human Fibronectin Protein (His Tag), HPLC-verifiedBiological Activity : Background : Fibronectin (FN) is a glycoprotein component of the extracellular matrix of the extracellular matrix (ECM) with roles…
Name : Recombinant Human Fibromodulin Protein (hFc Tag)Biological Activity : Background : Fibromodulin (FMOD), an ECM small leucine-rich proteoglycan (SLRP), was reported to promote angiogenesis not only during wound healing,…
Name : Recombinant Human FHIT Protein (His Tag)Biological Activity : Background : Fragile histidine triad, also known as FHIT, may play a key role in differentiating humans from apes. Fragile…
Name : Recombinant Human FH/Fumarate Hydratase Protein (His Tag), HPLC-verifiedBiological Activity : Background : Fumarate Hydratase (FH) is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle,…
Name : Recombinant Human FGL1 Protein (mFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_004458.3NCBI…
Name : Recombinant Human FGL1 Protein (His & AVI Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No.…
Name : Recombinant Human FGL1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Measured by its ability to bind with human LAG3 (Cat:16498-HNAH) in a functional ELISA.Expression…
Name : Recombinant Canine PD-L1/B7-H1 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : Programmed death-1 ligand-1 (PD-L1, CD274, B7-H1) has been identified as the ligand for the immunoinhibitory receptor…
Name : Recombinant Human FGL1 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Loaded Human LAG-3 Protein,mFc Tag (Cat.No.16498-H05H) on AMC Biosensor, can bind Human FGL-1 protein, hFc…
Name : Recombinant Human Fibrinogen Gamma Chain Protein, HPLC-verifiedBiological Activity : Background : Loss of function mutations in FGG have been associated with fibrinogen deficiency. FGG mRNA was expressed abnormally…
Name : Recombinant Human FGFR4 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Fibroblast growth factor receptor 4 (FGFR4) also known as CD334 antigen or tyrosine kinase related to…
Name : Recombinant Human FGFR4 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Fibroblast growth factor receptor 4 (FGFR4) also known as CD334 antigen or tyrosine kinase related to fibroblast…
Name : Recombinant Human FGFR4 Protein (hFc Tag)Biological Activity : Background : Fibroblast growth factor receptor 4 (FGFR4) also known as CD334 antigen or tyrosine kinase related to fibroblast growth…
Name : Recombinant Human FGFR3 Protein (ECD, alpha IIIb, His Tag), HPLC-verifiedBiological Activity : Background : FGFR3, also known as CD333, is a member of the fibroblast growth factor receptor…
Name : Recombinant Human FGFR3 Protein (alpha IIIb, hFc Tag)Biological Activity : Background : FGFR3, also known as CD333, is a member of the fibroblast growth factor receptor (FGFR) family,…
Name : Recombinant Human FGFR3 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : FGFR3, also known as CD333, is a member of the fibroblast growth factor receptor (FGFR) family,…
Name : Recombinant Human FGFR3 Protein (ECD, hFc Tag)Biological Activity : Background : FGFR3, also known as CD333, is a member of the fibroblast growth factor receptor (FGFR) family, with…
Name : Recombinant Human FGFR2 Protein (ECD, alpha(IIIb), His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : FGFR2, also known as CD332, belongs to the fibroblast growth factor receptor…
Name : Recombinant Canine PD-1 Protein (His & AVI Tag), BiotinylatedBiological Activity : Background : Programmed cell death 1, also known as PDCD1, is a type I transmembrane glycoprotein, and…
Name : Recombinant Human FGFR2 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : FGFR2, also known as CD332, belongs to the fibroblast growth factor receptor subfamily where amino acid…
Name : Recombinant Human FGFR2 Protein (alpha IIIb, hFc Tag), HPLC-verifiedBiological Activity : Background : FGFR2, also known as CD332, belongs to the fibroblast growth factor receptor subfamily where amino…
Name : Recombinant Human FGFR2 Protein (beta IIIc, His Tag)Biological Activity : Background : FGFR2, also known as CD332, belongs to the fibroblast growth factor receptor subfamily where amino acid…
Name : Recombinant Human FGFR2 Protein (aa 400-821, His & GST Tag)Biological Activity : Background : FGFR2, also known as CD332, belongs to the fibroblast growth factor receptor subfamily where…
Name : Recombinant Human FGFR2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : FGFR2, also known as CD332, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence…
Name : Recombinant Human FGFR2 Protein (His & hFc Tag)Biological Activity : Background : FGFR2, also known as CD332, belongs to the fibroblast growth factor receptor subfamily where amino acid…
Name : Recombinant Human FGFR1OP Protein (His & GST Tag)Biological Activity : Background : FOP( fibroblast growth factor receptor 1 oncogene partner) is a largely hydrophilic protein postulated to be…
Name : Recombinant Human FGFR1 Protein (alpha (IIIb), His Tag)Biological Activity : Background : FGFR1, also known as CD331, belongs to the fibroblast growth factor receptor subfamily where amino acid…
Name : Recombinant Human FGFR1 Protein (alpha (IIIb), hFc Tag)Biological Activity : Background : FGFR1, also known as CD331, belongs to the fibroblast growth factor receptor subfamily where amino acid…
Name : Recombinant Human FGFR1 Protein (beta (IIIb), His Tag)Biological Activity : Background : FGFR1, also known as CD331, belongs to the fibroblast growth factor receptor subfamily where amino acid…
Name : Recombinant Canine PD-1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Programmed cell death 1, also known as PDCD1, is a type I transmembrane glycoprotein, and is an…
Name : Recombinant Human FGFR1 Protein (beta (IIIb), hFc Tag)Biological Activity : Background : FGFR1, also known as CD331, belongs to the fibroblast growth factor receptor subfamily where amino acid…
Name : Recombinant Human FGFR1 Protein (His & GST Tag)Biological Activity : Background : FGFR1, also known as CD331, belongs to the fibroblast growth factor receptor subfamily where amino acid…
Name : Recombinant Human FGFR1 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : FGFR1, also known as CD331, belongs to the fibroblast growth factor receptor subfamily where amino acid…
Name : Recombinant Human FGFR1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : FGFR1, also known as CD331, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence…
Name : Recombinant Human FGFR1 Protein (ECD, hFc Tag)Biological Activity : Background : FGFR1, also known as CD331, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence…
Name : Recombinant Human FGFBP3 Protein (His Tag)Biological Activity : Background : FGFBP3 is a member of the fibroblast growth factor-binding protein family. Members of this family binds and activates…
Name : Recombinant Human FGF-9 Protein, HPLC-verifiedBiological Activity : Background : Fibroblast growth factor 9 (FGF9) also known as Glia-activating factor or Heparin-binding growth factor 9, is a member of…
Name : Recombinant Human FGF-9 Protein (hFc Tag)Biological Activity : Background : Fibroblast growth factor 9 (FGF9) also known as Glia-activating factor or Heparin-binding growth factor 9, is a member…
Name : Recombinant Human FGF-8 ProteinBiological Activity : Background : In mammalian embryos, transient Fgf8 expression defines the developing isthmic region, lying between the midbrain and the first rhombomere, but…
Name : Recombinant Human FGF-8 ProteinBiological Activity : Background : In mammalian embryos, transient Fgf8 expression defines the developing isthmic region, lying between the midbrain and the first rhombomere, but…
Name : Recombinant Canine PD-1 Protein (hFc Tag)Biological Activity : Background : Programmed cell death 1, also known as PDCD1, is a type I transmembrane glycoprotein, and is an immunoreceptor…
Name : SARS-CoV-2 (2019-nCoV) Spike S2-mFc Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Recombinant Human FGF6 ProteinBiological Activity : Background : FGF6, also known as FGF-6, belongs to the fibroblast growth factor (FGF) family. Members of this family possess broad mitogenic…
Name : Recombinant Human FGF-4 Protein, HPLC-verifiedBiological Activity : Background : FGF (fibroblast growth factor) signalling is known to be required for many aspects of mesoderm formation and patterning during…
Name : Recombinant Human FGF-21 ProteinBiological Activity : Background : Fibroblast growth factor 21 (FGF21) is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad…
Name : Recombinant Human FGF-21 Protein (His Tag)Biological Activity : Background : Fibroblast growth factor 21 (FGF21) is a member of the fibroblast growth factor (FGF) family. FGF family members…
Name : Recombinant Human basic FGF/FGF2 Protein, GMP gradeBiological Activity : Background : Basic fibroblast growth factor (bFGF), also known as FGF2, is a member of the fibroblast growth factor…
Name : Recombinant Human basic FGF/FGF2 ProteinBiological Activity : Background : Basic fibroblast growth factor (bFGF), also known as FGF2, is a member of the fibroblast growth factor (FGF) family.…
Name : Recombinant Human FGF-19 Protein, HPLC-verifiedBiological Activity : Background : FGF19, also known as FGF-19, is a member of the fibroblast growth factor (FGF) family. FGF family members possess…
Name : Recombinant Human FGF-18 Protein (His Tag)Biological Activity : Background : Fibroblast growth factor 18 (FGF18) is a member of the fibroblast growth factor (FGF) family. FGF family members…
Name : Recombinant Human FGF-17 ProteinBiological Activity : Background : FGF-13, also known as FGF17, belongs to the fibroblast growth factor (FGF) family. Members of this family show broad mitogenic…
Name : Recombinant Human, Cynomolgus FGF16 ProteinBiological Activity : Background : Fibroblast growth factor 16 (FGF16) is preferentially expressed in the heart after birth, suggesting its regulation is associated with…
Name : Recombinant Canine NOV/CCN3 Protein (His Tag)Biological Activity : Background : Protein NOV homolog, also known as Nephroblastoma-overexpressed gene protein homolog, NOV, and CCN3, is a putative ligand for…
Name : Recombinant Human FGF14 Protein (isoform 1B)Biological Activity : Background : FGF14 is a member of the fibroblast growth factor (FGF) family. Members of this family possess broad mitogenic…
Name : Recombinant Human FGF-10 Protein, HPLC-verifiedBiological Activity : Background : Fibroblast growth factor 10 (FGF10) is a member of the fibroblast growth factor (FGF) family. FGF family members possess…
Name : Recombinant Human FGF1 ProteinBiological Activity : Background : aFGF, also known as FGF1 and HBGF-1, is a member of the fibroblast growth factor family. The biological activity of…
Name : Recombinant Human Fetuin B Protein (His Tag)Biological Activity : Background : Fetuin-B, also known as Fetuin-like protein IRL685 and FETUB, is a secreted protein which belongs to thefetuin…
Name : Recombinant Human Fetuin A/FETUA Protein (His Tag), HPLC-verifiedBiological Activity : Background : Fetuin-A, also known as Alpha-2-HS-Glycoprotein (AHSG), belongs to the Fetuin family, is a plasma binding protein,…
Name : Recombinant Human FES Protein (His & GST Tag)Biological Activity : Background : Proto-oncogene tyrosine-protein kinase Fes/Fps, also known as Proto-oncogene c-Fes, Proto-oncogene c-Fps, Feline sarcoma oncogene, FES and…
Name : Recombinant Human Ferritin light chain Protein (His Tag), HPLC-verifiedBiological Activity : Background : Ferritin, light polypeptide (FTL) is the light subunit of the ferritin protein. Ferritin is the…
Name : Recombinant Human FDPS Protein (His Tag)Biological Activity : Background : Z-farnesyl diphosphate synthase (FDPS) is an enzyme belonging to the family of transferases, specifically those transferring aryl or…
Name : Recombinant Human FCRL2 Protein (His Tag)Biological Activity : Background : Fc receptor-like 2 (FCRL2) is highly expressed on B-cell chronic lymphocytic leukemia (B-CLL) cells and could possibly influence…
Name : Recombinant Human FCRL1 Protein (His Tag)Biological Activity : Background : Fc receptor-like protein 1, also known as FcR-like protein 1, Fc receptor homolog 1, IFGP family protein 1,…
Name : Recombinant Canine Neuregulin-1/NRG1 Protein (ECD)Biological Activity : Background : Neuregulin 1 or NRG1 is one of four proteins in the neuregulin family that act on the EGFR family…
Name : Recombinant Human FCMR/FAIM3 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_005440.1NCBI…
Name : Recombinant Human FCGRT & B2M Heterodimer Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Biological Activity : 1. Measured by its ability to bind human…
Name : Recombinant Human FCGRT & B2M Heterodimer Protein (His & AVI Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag :…
Name : Recombinant Human FCGRT & B2M Heterodimer Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Biological Activity : 1.Using the Octet RED System, the affinity constant (Kd) of…
Name : Recombinant Human FCGRT & B2M Heterodimer Protein (His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : 1. Measured by its ability to bind human IgG1 (Cat: 10702-HNAC)…
Name : Recombinant Human Fc epsilon RI Protein (ECD), HPLC-verifiedBiological Activity : Background : FcERI, also known as FCER1A, is the alpha subunit of the immunoglobulin epsilon receptor (IgE receptor).…
Name : Recombinant Human Fc epsilon RI Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : FcERI, also known as FCER1A, is the alpha subunit of the immunoglobulin epsilon receptor…
Name : Recombinant Human FASN Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : E. coliTag : Protein Accession No. : P49327NCBI…
Name : Recombinant Human Fas Ligand/TNFSF6 Protein (His Tag)Biological Activity : Background : Fas Ligand, also known as FASLG and CD95L, is the ligand for FAS. It is a transmembrane…
Name : Recombinant Human Fas/CD95/TNFRSF6 Protein (ECD, His Tag)Biological Activity : Background : CD95 (APO-1/Fas) is an important inducer of the extrinsic apoptosis signaling pathway and therapy induced apoptosis of…
Name : Recombinant Canine Neuregulin-1/NRG1 Protein (ECD, His Tag)Biological Activity : Background : Neuregulin 1 or NRG1 is one of four proteins in the neuregulin family that act on the…
Name : Recombinant Human Fas/CD95/TNFRSF6 Protein (hFc Tag)Biological Activity : Background : CD95 (APO-1/Fas) is an important inducer of the extrinsic apoptosis signaling pathway and therapy induced apoptosis of many…
Name : Recombinant Human FAP Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Seprase, also known as 17 kDa melanoma membrane-bound gelatinase , Fibroblast activation protein…
Name : Recombinant Human FAP Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Seprase, also known as 17 kDa melanoma membrane-bound gelatinase , Fibroblast activation protein alpha, Integral membrane…
Name : Recombinant Human FAP Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Seprase, also known as 17 kDa melanoma membrane-bound gelatinase , Fibroblast activation protein alpha, Integral membrane…
Name : Recombinant Human FAP Protein (ECD, His Tag)Biological Activity : Background : Seprase, also known as 17 kDa melanoma membrane-bound gelatinase , Fibroblast activation protein alpha, Integral membrane serine…
Name : Recombinant Human FANCA Protein (His Tag), HPLC-verifiedBiological Activity : Background : FANCA is one of the six known Fanconi anemia gene products (FANCA, FANCC, FANCD2, FANCE, FANCF, and…
Name : Recombinant Human FAM3D Protein (His Tag)Biological Activity : Background : Family with sequence similarity 3 (FAM3) family is a novel cytokine-like gene family, which has four genes in…
Name : Recombinant Human FAM3C Protein (His Tag)Biological Activity : Background : FAM3C, also known as ILEI, is a member of theFAM3 family. It can be detected in resent in…
Name : Recombinant Human FAM3C Protein (hFc Tag)Biological Activity : Background : FAM3C, also known as ILEI, is a member of theFAM3 family. It can be detected in resent in…
Name : Recombinant Human FAM3B Protein (hFc Tag)Biological Activity : Background : Pancreatic derived factor, also known as FAM3B, is an islet-specific secreted cytokine specifically expressed at high levels in…
Name : Recombinant Canine Neuregulin-1/NRG1 Protein (His Tag)Biological Activity : Background : Neuregulin 1 or NRG1 is one of four proteins in the neuregulin family that act on the EGFR…
Name : Recombinant Human FAM20C Protein (His Tag)Biological Activity : Background : The Family with sequence similarity 20 member C (FAM20C) catalyzes the phosphorylation of secreted proteins, and participates in…
Name : Recombinant Human FAM20B Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_055679.1NCBI…
Name : Recombinant Human FAM19A4 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : Q96LR4NCBI…
Name : Recombinant Human FAM171B Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : AAH60872.1NCBI…
Name : Recombinant Human FAM171B Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : AAH60872.1NCBI…
Name : Recombinant Human FAM150A Protein (mFc Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human Factor XIII Protein (His Tag), HPLC-verifiedBiological Activity : Background : Coagulation factor XIII B chain, also known as Fibrin-stabilizing factor B subunit, Protein-glutamine gamma-glutamyltransferase B chain,…
Name : Recombinant Human Factor XI Protein (His Tag), HPLC-verifiedBiological Activity : Background : Factor XI (plasma thromboplastin antecedent) is a plasma glycoprotein, and a zymogen acting as a serine…
Name : Recombinant Human Factor X Protein (His Tag), HPLC-verifiedBiological Activity : Background : Coagulation factor X, also known as FX, F10, Eponym Stuart-Prower factor, and thrombokinase, is an enzyme…
Name : Recombinant Human Factor VII Protein (His Tag)Biological Activity : Background : Coagulation factor VII, also known as Serum prothrombin conversion accelerator, Factor VII, F7 and FVII, is a…
Name : Recombinant Canine Neuregulin-1/NRG1 Protein (EGF Domain, mFc Tag)Biological Activity : Background : Neuregulin 1 or NRG1 is one of four proteins in the neuregulin family that act on…
Name : Recombinant Human Factor IX Protein (His Tag), HPLC-verifiedBiological Activity : Background : Coagulation factor IX, also known as Christmas factor, Plasma thromboplastin component and PTC, is a secreted…
Name : Recombinant Human Factor IX Protein (hFc Tag)Biological Activity : Background : Coagulation factor IX, also known as Christmas factor, Plasma thromboplastin component and PTC, is a secreted protein…
Name : Recombinant Human Factor H Protein (His Tag), HPLC-verifiedBiological Activity : Background : Complement Factor H, also known as H factor 1, and CFH, is a sialic acid containing…
Name : Recombinant Human Factor D Protein (His Tag)Biological Activity : Background : Complement Factor D, also known as Adipsin, C3 convertase activator, Properdin Factor D and CFD is a…
Name : Recombinant Human Factor B Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human FABP6 ProteinBiological Activity : Background : Gastrotropin, also known as Fatty acid-binding protein 6, Ileal lipid-binding protein, ILBP, Intestinal 15 kDa protein, Intestinal bile acid-binding protein,…
Name : Recombinant Human FABP5 ProteinBiological Activity : Background : Fatty acid-binding protein, also known as Epidermal-type fatty acid-binding protein, Fatty acid-binding protein 5, Psoriasis-associated fatty acid-binding protein homolog, E-FABP…
Name : Recombinant Human FABP4/A-FABP Protein (29 Ala/Thr, His Tag)Biological Activity : Background : Fatty acid-binding protein, adipocyte, also known as Adipocyte-type fatty acid-binding protein, Fatty acid-binding protein 4, Adipocyte…
Name : Recombinant Human FABP3/H-FABP ProteinBiological Activity : Background : Fatty acid binding protein 3 (FABP3, also termed heart-type fatty acid binding protein) is a member of the intracellular lipid-binding…
Name : Recombinant Human FABP2 Protein (His Tag)Biological Activity : Background : Fatty acid binding protein (FABP) is one of the intracellular proteins, with a low molecular weight of approximately…
Name : Recombinant Canine Neuregulin-1/NRG1 Protein (ECD, hFc Tag)Biological Activity : Background : Neuregulin 1 or NRG1 is one of four proteins in the neuregulin family that act on the…
Name : Recombinant Human Ezrin Protein (His Tag)Biological Activity : Background : VIL2, also known as villin-2, belongs to the ERM protein family. It is expressed in cerebral cortex, basal…
Name : Recombinant Human Exosome Component 9/EXOSC9 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No.…
Name : Recombinant Human EVI2A Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_055025.2NCBI…
Name : Recombinant Human ETHE1 Protein (His Tag)Biological Activity : Background : ETHE1, also known as HSCO, is a sulfur dioxygenase that localizes within the mitochondrial matrix. ETHE1 probably plays…
Name : Recombinant Human ESM1 Protein (His Tag)Biological Activity : Background : ESM1 is a secreted protein which is produced by adipocytes. It has been noticed that ESM1 may play…
Name : Recombinant Human ESD Protein (His Tag)Biological Activity : Background : Esterase D, also known as ESD, is a serine hydrolase that belongs to the esterase D family. Esterase…
Name : Recombinant Human ESAM ProteinBiological Activity : Background : Endothelial cell-selective adhesion molecule (ESAM) is a member of JAM family of immunoglobulin superfamily and consists of one V-type and…
Name : Recombinant Human ESAM Protein (His Tag)Biological Activity : Background : Endothelial cell-selective adhesion molecule (ESAM) is a member of JAM family of immunoglobulin superfamily and consists of one…
Name : Recombinant Human ESAM Protein (hFc Tag)Biological Activity : Background : Endothelial cell-selective adhesion molecule (ESAM) is a member of JAM family of immunoglobulin superfamily and consists of one…
Name : Human EPO Protein (Fc Tag)Biological Activity : Background : Erythropoietin is a member of the EPO / TPO family. It is a secreted, glycosylated cytokine composed of four…
Name : Recombinant Canine Lymphotactin/XCL1/SCYC1 Protein (His Tag)Biological Activity : Background : This antimicrobial gene encodes a member of the chemokine superfamily. Chemokines function in inflammatory and immunological responses, inducing…
Name : Recombinant Human ERP72 Protein (His Tag)Biological Activity : Background : ERP72, also known as PDIA4, is an endoplasmic reticulum luminal protein which belongs to the protein disulfide isomerase…
Name : Recombinant Human ERP72 Protein (hFc Tag)Biological Activity : Background : ERP72, also known as PDIA4, is an endoplasmic reticulum luminal protein which belongs to the protein disulfide isomerase…
Name : Recombinant Human ERP44 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_055866.1NCBI…
Name : Recombinant Human ERP27 Protein (mFc Tag)Biological Activity : Background : ERP27 contains 1 thioredoxin domain and is a noncatalytic member of the protein disulfide isomerase family. Protein disulfide…
Name : Recombinant Human ERK2 Protein (GST Tag), HPLC-verifiedBiological Activity : Background : MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical…
Name : Recombinant Human ERH Protein (His Tag)Biological Activity : Background : ERH(enhancer of rudimentary homolog) belongs to the E(R) family. It is expressed in all tissues examined. The monomeric…
Name : Recombinant Human, Rhesus ERBB4/Her4 Protein (His Tag), HPLC-verifiedBiological Activity : Background : ERBB4 is a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain,…
Name : Recombinant Human, Rhesus ERBB4/Her4 Protein (hFc Tag)Biological Activity : Background : ERBB4 is a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a…
Name : Recombinant Human ERAP2 Protein (His Tag)Biological Activity : Background : Leukocyte-derived arginine aminopeptidase (LRAP), also known as endoplasmic reticulum-aminopeptidase 2 (ERAP2), is the second identified aminopeptidase localized in…
Name : Recombinant Human EPOR & CD131 Heterodimer Protein (hFc Tag)Biological Activity : Background : Biological Activity : 1. Measured by its ability to bind rat EPO-His (Cat:80055-R08B) in a…
Name : Recombinant Canine IL-3R alpha/CD123 Protein (His Tag)Biological Activity : Background : Interleukin-3 receptor subunit alpha, also known as IL-3 receptor subunit alpha, IL-3R-alpha, CD123, and IL3RA, is a…
Name : Recombinant Human Erythropoietin R/EPOR Protein (ECD, His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Erythropoietin (EPO) is the major glycoprotein hormone regulator of mammalian erythropoiesis, and is produced…
Name : Recombinant Human Erythropoietin R/EPOR Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Erythropoietin (EPO) is the major glycoprotein hormone regulator of mammalian erythropoiesis, and is produced by…
Name : Recombinant Human Erythropoietin R/EPOR Protein (hFc Tag)Biological Activity : Background : Erythropoietin (EPO) is the major glycoprotein hormone regulator of mammalian erythropoiesis, and is produced by kidney and…
Name : Recombinant Human Epiregulin Protein (hFc Tag)Biological Activity : Background : Epiregulin (EREG) is a member of the epidermal growth factor family. Epiregulin (EREG) can function as a ligand…
Name : Recombinant Human Epiphycan Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : AAH30958.1NCBI…
Name : Recombinant Human EPHX2 Protein (His Tag)Biological Activity : Background : Genetic variation in EPHX2 was significantly associated with risk of incident CHD in Caucasians, implicating EPHX2 as a…
Name : Recombinant Human Ephrin B2 ProteinBiological Activity : Background : EphrinB2 also known as EFNB2 is a member of the ephrin family. EphrinB2 is involved in establishing arterial versus…
Name : Recombinant Human Ephrin B2 Protein (His Tag)Biological Activity : Background : EphrinB2 also known as EFNB2 is a member of the ephrin family. EphrinB2 is involved in establishing…
Name : Recombinant Human Ephrin B2 Protein (His & hFc Tag)Biological Activity : Background : EphrinB2 also known as EFNB2 is a member of the ephrin family. EphrinB2 is involved…
Name : Recombinant Human Ephrin-B1 Protein (His Tag)Biological Activity : Background : Ephrin-B1 also known as EFNB1, is a member of the ephrin family. The transmembrane- associated ephrin ligands and…
Name : Recombinant Canine IL-25/IL-17E Protein (hFc Tag)Biological Activity : Background : Interleukin-25 (IL-25) is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation,…
Name : Recombinant Human Ephrin-B1 Protein (His & hFc Tag)Biological Activity : Background : Ephrin-B1 also known as EFNB1, is a member of the ephrin family. The transmembrane- associated ephrin…
Name : Recombinant Human Ephrin A5 Protein (His Tag)Biological Activity : Background : Ephrin-A5 also known as EFNA5, is a member of the Ephrin family. The Eph family receptor interacting…
Name : Recombinant Human Ephrin A5 Protein (hFc Tag)Biological Activity : Background : Ephrin-A5 also known as EFNA5, is a member of the Ephrin family. The Eph family receptor interacting…
Name : Recombinant Human Ephrin A4 Protein (His Tag)Biological Activity : Background : EPH-related receptor tyrosine kinase ligand 4 (Ephrin-A4) also known as EFNA4, is a member of the Ephrin…
Name : Recombinant Human Ephrin A4 Protein (hFc Tag)Biological Activity : Background : EPH-related receptor tyrosine kinase ligand 4 (Ephrin-A4) also known as EFNA4, is a member of the Ephrin…
Name : Recombinant Human Ephrin A3 ProteinBiological Activity : Background : Ephrin-A3 also known as EPH-related receptor tyrosine kinase ligand 3 or EFNA3, is a member of the ephrin family.…
Name : Recombinant Human Ephrin A3 Protein (His Tag)Biological Activity : Background : Ephrin-A3 also known as EPH-related receptor tyrosine kinase ligand 3 or EFNA3, is a member of the…
Name : Recombinant Human Ephrin A3 Protein (hFc Tag)Biological Activity : Background : Ephrin-A3 also known as EPH-related receptor tyrosine kinase ligand 3 or EFNA3, is a member of the…
Name : Recombinant Human Ephrin-A1 Protein (His Tag)Biological Activity : Background : EPH-related receptor tyrosine kinase ligand 1 (abbreviated as Ephrin-A1) also known as ligand of eph-related kinase 1 or…
Name : Recombinant Human Ephrin-A1 Protein (hFc Tag)Biological Activity : Background : EPH-related receptor tyrosine kinase ligand 1 (abbreviated as Ephrin-A1) also known as ligand of eph-related kinase 1 or…
Name : Recombinant Canine IL22RA1 Protein (His Tag)Biological Activity : Background : IL-22R belongs to the type II cytokine receptor family. It contains 2 fibronectin type-III domains and is expressed…
Name : SARS-CoV-2 (2019-nCoV) Spike S2 ECD-Fc Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the…
Name : Recombinant Human EphB6 ProteinBiological Activity : Background : Ephrins are divided into the ephrin-A (EFNA) class and the ephrin-B (EFNB) class based on their structures and sequence relationships.…
Name : Recombinant Human EphB6 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Ephrins are divided into the ephrin-A (EFNA) class and the ephrin-B (EFNB) class based on their structures…
Name : Recombinant Human EphB6 Protein (hFc Tag)Biological Activity : Background : Ephrins are divided into the ephrin-A (EFNA) class and the ephrin-B (EFNB) class based on their structures and…
Name : Recombinant Human EphB4 Protein, HPLC-verifiedBiological Activity : Background : Ephrin type-B receptor 4 is a protein that in humans is encoded by the EphB4 gene. It is a…
Name : Recombinant Human EphB4 Protein (aa 563-987, His & GST Tag)Biological Activity : Background : Ephrin type-B receptor 4 is a protein that in humans is encoded by the…
Name : Recombinant Human EphB4 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Ephrin type-B receptor 4 is a protein that in humans is encoded by the EphB4 gene.…
Name : Recombinant Human EphB4 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Ephrin type-B receptor 4 is a protein that in humans is encoded by the EphB4 gene. It…
Name : Recombinant Human EphB4 Protein (hFc Tag)Biological Activity : Background : Ephrin type-B receptor 4 is a protein that in humans is encoded by the EphB4 gene. It is…
Name : Recombinant Human EphB2 Protein (aa 570-987, His & GST Tag)Biological Activity : Background : Ephrin type-B receptor 2, also known as EphB2, belongs to the ephrin receptor subfamily…
Name : Recombinant Human EphB2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Ephrin type-B receptor 2, also known as EphB2, belongs to the ephrin receptor subfamily of the protein-tyrosine…
Name : Recombinant Canine IL22RA1 Protein (hFc Tag)Biological Activity : Background : IL-22R belongs to the type II cytokine receptor family. It contains 2 fibronectin type-III domains and is expressed…
Name : Recombinant Human EphB2 Protein (His & hFc Tag)Biological Activity : Background : Ephrin type-B receptor 2, also known as EphB2, belongs to the ephrin receptor subfamily of the…
Name : Recombinant Human EphB1 Protein (aa 565-984, His & GST Tag)Biological Activity : Background : Ephrin type-B receptor 1, also known as EphB1, belongs to the ephrin receptor subfamily…
Name : Recombinant Human EphB1 Protein (His Tag)Biological Activity : Background : Ephrin type-B receptor 1, also known as EphB1, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase…
Name : Recombinant Human EphA8 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_065387.1NCBI…
Name : Recombinant Human EphA7 Protein (His & GST Tag)Biological Activity : Background : Ephrin type-A receptor 7, also known as EphA7, belongs to the ephrin receptor subfamily of the…
Name : Recombinant Human EphA7 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Ephrin type-A receptor 7, also known as EphA7, belongs to the ephrin receptor subfamily of the protein-tyrosine…
Name : Recombinant Human EphA4 Protein (aa 570-986, His & GST Tag)Biological Activity : Background : EPH receptor A4 (ephrin type-A receptor 4), also known as EphA4, belongs to the…
Name : Recombinant Human EphA4 Protein (His Tag)Biological Activity : Background : EPH receptor A4 (ephrin type-A receptor 4), also known as EphA4, belongs to the ephrin receptor subfamily of…
Name : Recombinant Human EphA4 Protein (His & hFc Tag)Biological Activity : Background : EPH receptor A4 (ephrin type-A receptor 4), also known as EphA4, belongs to the ephrin receptor…
Name : Recombinant Human EphA3 Protein (His Tag)Biological Activity : Background : EphA3 gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have…
Name : Recombinant Canine IL-21 ProteinBiological Activity : Background : IL21 belongs to the IL-15/IL-21 family. It is a cytokine with immunoregulatory activity. Cytokines are proteinaceous signaling compounds that are…
Name : Recombinant Human EphA2 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Eph receptor A2 (Ephrin type-A receptor 2 or EphA2) is a member of…
Name : Recombinant Human EphA2 Protein (aa 585-976, His & GST Tag)Biological Activity : Background : Eph receptor A2 (Ephrin type-A receptor 2 or EphA2) is a member of the…
Name : Recombinant Human EphA2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Eph receptor A2 (Ephrin type-A receptor 2 or EphA2) is a member of the ephrin receptor subfamily…
Name : Recombinant Human EphA2 Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : Eph receptor A2 (Ephrin type-A receptor 2 or EphA2) is a member of the ephrin receptor subfamily…
Name : Recombinant Human EphA1 Protein (ECD, His Tag)Biological Activity : Background : EphA1 or EPH receptor A1 belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. Receptors…
Name : Recombinant Human EphA1 Protein (hFc Tag)Biological Activity : Background : EphA1 or EPH receptor A1 belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. Receptors in…
Name : Recombinant Human EPDR1 Protein (His Tag)Biological Activity : Background : EPDR1 is a member of the ependymin family. EPDR1 is a type II transmembrane protein that is similar…
Name : Recombinant Human EPCR Protein (His Tag), HPLC verifiedBiological Activity : Background : Endothelial protein C receptor (EPCR), also known as activated protein C receptor (APC receptor) or PROCR,…
Name : Recombinant Human EPCR Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : Endothelial protein C receptor (EPCR), also known as activated protein C receptor (APC receptor) or PROCR, is…
Name : Recombinant Human EpCAM/TROP1 Protein (ECD, hFc & AVI Tag), BiotinylatedBiological Activity : Background : Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type I…
Name : Recombinant Canine IL-20R alpha/IL-20RA Protein (hFc Tag)Biological Activity : Background : Interleukin 20 receptor, alpha subunit (IL20RA/IL-20RA) also known as IL-20 receptor subunit alpha, Cytokine receptor class-II member…
Name : Recombinant Human EpCAM/TROP1 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type…
Name : Recombinant Human EpCAM/TROP1 Protein (His Tag), Amine-Labeled Biotinylated, HPLC-verifiedBiological Activity : Background : Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type I transmembrane…
Name : Recombinant Human EpCAM/TROP1 Protein (Dimer, ECD, His Tag), HPLC-verifiedBiological Activity : Background : Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type I transmembrane…
Name : Recombinant Human EpCAM/TROP1 Protein (ECD, mFc Tag), HPLC-verifiedBiological Activity : Background : Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type I transmembrane glycoprotein…
Name : Recombinant Human EpCAM/TROP1 Protein (hFc Tag), Amine-Labeled Biotinylated, HPLC-verifiedBiological Activity : Background : Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type I transmembrane…
Name : Recombinant Human EpCAM/TROP1 Protein (ECD, hFc Tag)Biological Activity : Background : Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type I transmembrane glycoprotein composed…
Name : Recombinant Human Eotaxin/CCL11 Protein (His Tag)Biological Activity : Background : CCL11 or chemokine (C-C motif) ligand 11 is a member of the chemokine (C-C motif) ligand family. Chemokin…
Name : Recombinant Human Eotaxin-2 Protein (His Tag)Biological Activity : Background : CCL24, also known as Eotaxin-2 and MPIF-2, belongs to the intercrine beta (chemokine CC) family. CCL24 gene belongs…
Name : Recombinant Human ENTPD5 Protein (His Tag)Biological Activity : Background : Ectonucleoside triphosphate diphosphohydrolase 5 (ENTPD5), also known as CD39 antigen-like 4, ER-UDPase, Guanosine-diphosphatase ENTPD5, Nucleoside diphosphatase Uridine-diphosphatase ENTPD5.…
Name : Recombinant Human CD39L3/ENTPD3 Protein (His Tag)Biological Activity : Background : Biological Activity : Measured by its ability to hydrolyze the 5’-phosphate group from the substrate adenosine-5’-triphosphate (ATP). The…
Name : Recombinant Canine IL-2 Protein (147 Cys/Ser)Biological Activity : Background : Interleukin-2, also known as a T-cell growth factor, TCGF, Aldesleukin, and IL2, is a secreted protein that belongs…
Name : Recombinant Human ENTPD2 Protein (aa 29-460, His Tag)Biological Activity : Background : NTPDase 2, also known as ENTPD2, belongs to the ecto-nucleoside triphosphate diphosphohydrolase family (E-NTPDase). Members of…
Name : Recombinant Human ENSA Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Endosulfine alpha, also known as ENSA, belongs to the endosulfine family. It is a highly conserved…
Name : Recombinant Human ENSA Protein (His Tag)Biological Activity : Background : Endosulfine alpha, also known as ENSA, belongs to the endosulfine family. It is a highly conserved cAMP-regulated phosphoprotein…
Name : Recombinant Human ENPP7 Protein (His Tag)Biological Activity : Background : Ectonucleotide pyrophosphatase / phosphodiesterase family member 7, also known as Alkaline sphingomyelin phosphodiesterase, Intestinal alkaline sphingomyelinase, Alk-Smase, ENPP7…
Name : Recombinant Human CD203c/ENPP-3 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant Human Autotaxin/ENPP-2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : ENPP2 (Ectonucleotide pyrophosphatase/phosphodiesterase family member 2), also referred as Autotaxin, is a secreted enzyme encoded by the…
Name : Recombinant Human ENPP-5 Protein (His Tag)Biological Activity : Background : ENPP5 is a member of the nucleotide pyrophosphatase/phosphodiesterase family (NPP). It is a family comprised of dimeric enzymes…
Name : Recombinant Human ENO3 Protein (His Tag)Biological Activity : Background : ENO3 is one of the three enolase isoenzymes found in mammals. As a homodimer, ENO3 is found in…
Name : Recombinant Human Enolase 1/ENO1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The ENO1 gene encodes a multifunctional enzyme that has been identified as a key component of…
Name : Recombinant Human Endothelin B Receptor Protein (His Tag)Biological Activity : Background : The hypermethylation of EDNRB gene was remarkably related to infiltration and metastasis of gastric cancer and…
Name : Recombinant Canine IL1R2 Protein (hFc Tag)Biological Activity : Background : Interleukin 1 receptor, type II (IL1R2) also known as CD121b (Cluster of Differentiation 121b) is a cytokine receptor…
Name : Recombinant Human Endothelin B Receptor Protein (mFc Tag)Biological Activity : Background : The hypermethylation of EDNRB gene was remarkably related to infiltration and metastasis of gastric cancer and…
Name : Recombinant Human Endoglin/CD105 Protein (ECD, His Tag)Biological Activity : Background : Endoglin, also known as CD105, is a type I homodimeric transmembrane glycoprotein with a large, disulfide-linked, extracellular…
Name : Recombinant Human Endoglin/CD105 Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : Endoglin, also known as CD105, is a type I homodimeric transmembrane glycoprotein with a large, disulfide-linked, extracellular…
Name : Recombinant Human EMAPII/AIMP1 Protein (His Tag)Biological Activity : Background : Aminoacyl tRNA synthase complex-interacting multifunctional protein 1, also known as Multisynthase complex auxiliary component p43, Endothelial monocyte-activating polypeptide…
Name : Recombinant Human ELK1 Protein (His & GST Tag)Biological Activity : Background : E twenty-six (ETS)-like transcription factor 1, also known as Elk1 or Member of ETS oncogene family…
Name : Recombinant Human Elafin Protein (His Tag)Biological Activity : Background : Elafin, also known as Elastase-specific inhibitor, Peptidase inhibitor 3, Protease inhibitor WAP3, Skin-derived antileukoproteinase, WAP four-disulfide core domain…
Name : Recombinant Human EIF5A2 Protein (His Tag)Biological Activity : Background : Eukaryotic translation initiation factor 5A2 (EIF5A2) has been demonstrated to be upregulated in numerous types of human cancer…
Name : Recombinant Human eIF5A Protein (His Tag)Biological Activity : Background : EIF-5A, also known as EIF5, functions in start site selection as a GTPase accelerating protein (GAP) for the…
Name : Recombinant Human EIF5 Protein (GST Tag)Biological Activity : Background : EIF-5A, also known as EIF5, functions in start site selection as a GTPase accelerating protein (GAP) for the…
Name : Recombinant Human eIF3K Protein (His & GST Tag)Biological Activity : Background : EIF3K is a member of the eIF3 subunit K family. It is a component of the…
Name : Recombinant Canine IL-18Rα Protein (ECD, His Tag)Biological Activity : Background : Interleukin-18 receptor 1 (IL18R1) also known as CD218 antigen-like family member A, CDw218a, IL1 receptor-related protein, and…
Name : Recombinant Human EGFR Protein (Isoform vIII, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : As a member of the epidermal growth factor receptor (EGFR) family, EGFR…
Name : Recombinant Human EGFR Protein (ECD, His & AVI Tag), BiotinylatedBiological Activity : Background : As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is…
Name : Recombinant Human EGFR Protein (Isoform vIII, His Tag), HPLC-verifiedBiological Activity : Background : As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type…
Name : Recombinant Human EGFR Protein (Isoform vIII, His Tag)Biological Activity : Background : As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I…
Name : Recombinant Human EGFR Protein (Isoform Viii, hFc Tag)Biological Activity : Background : As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I…
Name : Recombinant Human EGFR Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein…
Name : Recombinant Human EGFR Protein (aa 668-1210, His & GST Tag)Biological Activity : Background : As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is…
Name : Recombinant Human EGFR Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I…
Name : Recombinant Human EGFR Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I…
Name : Recombinant Human EGFL7 Protein (His Tag)Biological Activity : Background : Epidermal growth factor-like protein 7, also known as EGF-like protein 7, Multiple epidermal growth factor-like domains protein 7,…
Name : Recombinant Canine IL-18Rα Protein (hFc Tag)Biological Activity : Background : Interleukin-18 receptor 1 (IL18R1) also known as CD218 antigen-like family member A, CDw218a, IL1 receptor-related protein, and CD218a,…
Name : Recombinant Human EGF-L6 Protein (His & FLAG Tag)Biological Activity : Background : EGFL6, also known as EGF-L6, belongs to the epidermal growth factor (EGF) repeat superfamily. Members of…
Name : Recombinant Human EGF-L6 Protein (His Tag)Biological Activity : Background : EGFL6, also known as EGF-L6, belongs to the epidermal growth factor (EGF) repeat superfamily. Members of this superfamily…
Name : Recombinant Human EGF Protein (ECD), GMP grade, HPLC-verifiedBiological Activity : Background : EGF is the founding member of the EGF-family of proteins. Members of this protein family have…
Name : Recombinant Human EGF Protein (ECD), HPLC-verifiedBiological Activity : Background : EGF is the founding member of the EGF-family of proteins. Members of this protein family have highly similar…
Name : Recombinant Human EGF Protein (ECD, hFc Tag)Biological Activity : Background : EGF is the founding member of the EGF-family of proteins. Members of this protein family have highly…
Name : Recombinant Human EEF1E1 Protein (His Tag)Biological Activity : Background : EEF1E1, also known as AIMP3 and p18, is a multifunctional protein that localizes to both the cytoplasm and…
Name : Recombinant Human EEF1B2 Protein (His Tag)Biological Activity : Background : EF1B, also known as EEF1B2, is a translation elongation factor. It belongs to the EF-1-beta/EF-1-delta family. Elongation factors…
Name : Recombinant Human EED Protein (His & GST Tag)Biological Activity : Background : EED is essential for regulating the repressive histone modification, histone 3 lysine 27 tri-methylation (H3K27me3) at…
Name : Recombinant Human EDEM2 Protein (His Tag)Biological Activity : Background : EDEM2, also known as C2orf31, belongs to a family of proteins involved in ER-associated degradation (ERAD) of glycoproteins.…
Name : Recombinant Human EDAR Protein (His Tag)Biological Activity : Background : Tumor necrosis factor receptor superfamily member EDAR is a Single-pass type I membrane protein. Edar was expressed reiteratively…
Name : Recombinant Canine IL17RD Protein (His Tag)Biological Activity : Background : Interleukin-17 receptor D (IL-17RD) also known as Interleukin-17 receptor-like protein, is a member of the interleukine-17 receptor family.…
Name : Recombinant Human EDAR Protein (hFc Tag)Biological Activity : Background : Tumor necrosis factor receptor superfamily member EDAR is a Single-pass type I membrane protein. Edar was expressed reiteratively…
Name : Recombinant Human EDA2R/TNFRSF27 Protein (His Tag)Biological Activity : Background : Tumor necrosis factor receptor superfamily member 27, also known as X-linked ectodysplasin-A2 receptor, EDA-A2 receptor, EDA2R, XEDAR and…
Name : Recombinant Human EDA2R/TNFRSF27 Protein (hFc Tag)Biological Activity : Background : Tumor necrosis factor receptor superfamily member 27, also known as X-linked ectodysplasin-A2 receptor, EDA-A2 receptor, EDA2R, XEDAR and…
Name : Recombinant Human ECSIT Protein (His Tag)Biological Activity : Background : ECSIT is an adapter protein of the toll-like and IL-1 receptor signaling pathway that is involved in the…
Name : Recombinant Human ECH1 Protein (His Tag)Biological Activity : Background : ECH1 is a member of the hydratase/isomerase superfamily. ECH1 shows high sequence similarity to enoyl-CoA hydratases of several…
Name : Recombinant Human ECE2 Protein (His Tag)Biological Activity : Background : Endothelin-converting enzyme 2, also known as ECE-2, is a metalloprotease that possesses many properties consistent with it being…
Name : Recombinant Human ECE2 Protein (hFc Tag)Biological Activity : Background : Endothelin-converting enzyme 2, also known as ECE-2, is a metalloprotease that possesses many properties consistent with it being…
Name : Recombinant Human ECE1 Protein (His Tag)Biological Activity : Background : Endothelin-converting enzyme 1, also known as ECE-1, is a single-pass type II membrane protein which belongs to thepeptidase…
Name : Recombinant Human ECD Protein (His & GST Tag)Biological Activity : Background : ECD, also known as ecdysoneless homolog, belongs to the SGT1 family. It is highly expressed in…
Name : Recombinant Human EBP1 Protein (His Tag)Biological Activity : Background : EBP1, also known as PA2G4, is an RNA-binding protein that belongs to the peptidase M24 family. It can…
Name : Recombinant Canine IL17RD Protein (hFc Tag)Biological Activity : Background : Interleukin-17 receptor D (IL-17RD) also known as Interleukin-17 receptor-like protein, is a member of the interleukine-17 receptor family.…
Name : Recombinant Human EBAG9 Protein (His Tag)Biological Activity : Background : RCAS1, also known as EBAG9, is a tumor-associated antigen that is expressed at high frequency in a variety…
Name : Recombinant Human EB3 Protein (His Tag)Biological Activity : Background : MAPRE3 (Microtubule Associated Protein RP/EB Family Member 3, also known as EB3) is a Protein Coding gene. 2…
Name : Recombinant Human E-Selectin/CD62E Protein (ECD, His Tag)Biological Activity : Background : E-selectin, also known as endothelial leukocyte adhesion molecule-1 (ELAM-1) and CD62E, is an inducible adhesion molecule that…
Name : Recombinant Human E-Selectin/CD62E Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : E-selectin, also known as endothelial leukocyte adhesion molecule-1 (ELAM-1) and CD62E, is an inducible adhesion molecule…
Name : Recombinant Human E-Cadherin Protein (His Tag)Biological Activity : Background : Cadherins are calcium-dependent cell adhesion proteins which preferentially interact with themselves in a homophilic manner in connecting cells,…
Name : Recombinant Human E-Cadherin Protein (ECD, His Tag)Biological Activity : Background : Cadherins are calcium-dependent cell adhesion proteins which preferentially interact with themselves in a homophilic manner in connecting…
Name : Recombinant Human E-Cadherin Protein (hFc Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Cadherins are calcium-dependent cell adhesion proteins which preferentially interact with themselves in a homophilic manner in…
Name : Recombinant Human E-Cadherin Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : Cadherins are calcium-dependent cell adhesion proteins which preferentially interact with themselves in a homophilic manner in…
Name : Recombinant Human DYRK3 Protein (His & GST Tag)Biological Activity : Background : Dual specificity tyrosine-phosphorylation-regulated kinase 3, also known as Regulatory erythroid kinase, REDK and DYRK3, is a…
Name : Recombinant Human DYDC2 Protein (GST Tag)Biological Activity : Background : DPY30 domain containing 2 belongs to the dpy-30 family. Dumpy-30 family members act as determinants of male fertility…
Name : Recombinant Canine IL-17A ProteinBiological Activity : Background : IL17, also known as IL17a, is a cytokine that belongs to the IL-17 family. Cytokines are proteinaceous signaling compounds that…
Name : SARS-CoV-2 (2019-nCoV) Spike S1+S2 ECD-AVI & His Recombinant Protein, BiotinylatedBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain…
Name : Recombinant Human DUSP3 ProteinBiological Activity : Background : Vaccinia H1-related phosphatase (VHR) is classified as a dual-specificity phosphatase (DUSP), and the other name is dual-specificity phosphatase 3 (DUSP3).…
Name : Recombinant Human DUSP3 Protein (His & GST Tag)Biological Activity : Background : Vaccinia H1-related phosphatase (VHR) is classified as a dual-specificity phosphatase (DUSP), and the other name is…
Name : Recombinant Human DUSP14 Protein (His & MBP Tag)Biological Activity : Background : Dual specific phosphatase 14 / MAP-kinase phophatase-6 (DUSP14 / MKP6) is a member of Dual-specificity phosphatases…
Name : Recombinant Human Draxin Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_940947.3NCBI…
Name : Recombinant Human DR6/TNFRSF21 ProteinBiological Activity : Background : TNFRSF21 (death receptor-6, DR6) is an orphan TNF receptor superfamily member and belongs to a subgroup of receptors called death…
Name : Recombinant Human DR6/TNFRSF21 Protein (His Tag), HPLC-verifiedBiological Activity : Background : TNFRSF21 (death receptor-6, DR6) is an orphan TNF receptor superfamily member and belongs to a subgroup of…
Name : Recombinant Human DR6/TNFRSF21 Protein (hFc Tag)Biological Activity : Background : TNFRSF21 (death receptor-6, DR6) is an orphan TNF receptor superfamily member and belongs to a subgroup of receptors…
Name : Recombinant Human DR5/TRAIL R2 Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 10b, official symbol TNFRSF10B, also known as…
Name : Recombinant Human DR5/TRAIL R2 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 10b, official symbol TNFRSF10B, also known as Death receptor…
Name : Recombinant Human DR5/TRAIL R2 Protein (His Tag)Biological Activity : Background : Tumor necrosis factor receptor superfamily, member 10b, official symbol TNFRSF10B, also known as Death receptor 5, CD262,…
Name : Recombinant Canine IL-13 R alpha 2/IL13RA2 Protein (His Tag)Biological Activity : Background : Interleukin-13 receptor subunit alpha-2 (IL13RA2/IL-13RA2) is also known as cluster of differentiation 213A2 (CD213A2), IL-13…
Name : Recombinant Human DR5/TRAIL R2 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 10b, official symbol TNFRSF10B, also known as Death receptor…
Name : Recombinant Human DR4/TRAIL R1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 10a (TRAIL R1), also known as TRAIL receptor 1 (TRAIL…
Name : Recombinant Human DR4/TRAIL R1 Protein (hFc Tag)Biological Activity : Background : Tumor necrosis factor receptor superfamily, member 10a (TRAIL R1), also known as TRAIL receptor 1 (TRAIL R1)…
Name : Recombinant Human DR3/TNFRSF25 Protein (hFc Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), also known as Death receptor 3 (DR3) or…
Name : Recombinant Human DR3/TNFRSF25 Protein (hFc Tag)Biological Activity : Background : Tumor necrosis factor receptor superfamily, member 25 (TNFRSF25), also known as Death receptor 3 (DR3) or TNFRSF12 is…
Name : Recombinant Human DPYS ProteinBiological Activity : Background : DPYS, also known as dihydropyrimidinase, belongs to the DHOase family, hydantoinase/dihydropyrimidinase subfamily. DPYS catalyzes the second step of the reductive…
Name : Recombinant Human DPYS Protein (His & GST Tag)Biological Activity : Background : DPYS, also known as dihydropyrimidinase, belongs to the DHOase family, hydantoinase/dihydropyrimidinase subfamily. DPYS catalyzes the second…
Name : Recombinant Human DPP3 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Dipeptidyl peptidase 3 (DPP3) is a zinc-dependent peptidase distributed within the cytoplasm which cleaves dipeptides sequentially from…
Name : Recombinant Human DPP2 Protein (His Tag)Biological Activity : Background : DPP7 (dipeptidylpeptidase 7), also known as DPPII and DPP2, is a post-proline cleaving aminopeptidase expressed in quiescent lymphocytes.…
Name : Recombinant Human DPP10 Protein (His Tag)Biological Activity : Background : Inactive dipeptidyl peptidase 1, also known as Dipeptidyl peptidase IV-related protein 3, Dipeptidyl peptidase X, Dipeptidyl peptidase-like protein…
Name : Recombinant Canine IL-13 R alpha 2/IL13RA2 Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : Interleukin-13 receptor subunit alpha-2 (IL13RA2/IL-13RA2) is also known as cluster of differentiation 213A2 (CD213A2),…
Name : Recombinant Human DPEP2 Protein (His Tag)Biological Activity : Background : DPEP2 (MBD-2) belongs to the membrane-bound dipeptidase family. There are three members of this family as membrane-bound dipeptidase-1…
Name : Recombinant Human DPEP2 Protein (hFc Tag)Biological Activity : Background : DPEP2 (MBD-2) belongs to the membrane-bound dipeptidase family. There are three members of this family as membrane-bound dipeptidase-1…
Name : Recombinant Human DPEP1 Protein (His Tag)Biological Activity : Background : Dehydropeptidase-I, also known as DPEP1, is a kidney membrane enzyme. Its expression in normal colonic mucosa is very…
Name : Recombinant Human Doublecortin/DCX Protein (aa 45-150, GST Tag)Biological Activity : Background : DCX (doublecortin, N-GST chimera)contains 2 doublecortin domains and belongs to the doublecortin family. It is highly…
Name : Recombinant Human DOT1L ProteinBiological Activity : Background : Histone-lysine N-methyltransferase, H3 lysine-79 specific, also known as Histone H3-K79 methyltransferase, DOT1-like protein, Lysine N-methyltransferase 4 and DOT1L, is a…
Name : Recombinant Human Doppel/PRND Protein (His Tag), HPLC-verifiedBiological Activity : Background : Doppel (PRND) is a paralogue of the mammalian prion (PRNP) gene. It is abundant in testis and,…
Name : Recombinant Human Doppel/PRND Protein (hFc Tag)Biological Activity : Background : Doppel (PRND) is a paralogue of the mammalian prion (PRNP) gene. It is abundant in testis and, unlike…
Name : Recombinant Human Dopamine beta-Hydroxylase Protein (His Tag)Biological Activity : Background : DBH is a 29 kDa copper-containing oxygenase. It can be detected in noradrenergic nerve terminals of the…
Name : Recombinant Human DNMT2 Protein (GST Tag)Biological Activity : Background : DNMT2, also known as tRNA (cytosine-5-)-methyltransferase, DNA methyltransferase homolog HsaIIP, and TRDMT1, is a member of the DNA…
Name : Recombinant Human DNase I Protein (His Tag)Biological Activity : Background : DNase1, also known as deoxyribonuclease I and DNL1, is a member of the DNase family. DNaseI is…
Name : Recombinant Canine IL-11RA/IL-11R alpha ProteinBiological Activity : Background : Interleukin 11 receptor, alpha subunit (IL11RA/IL-11RA) is a subunit of the interleukin 11 receptor which is a member of…
Name : Recombinant Human DNAJC30 Protein (His Tag)Biological Activity : Background : DNAJC30 is a member of the DNAJ molecular chaperone homology domain-containing protein family. DNAJC30 gene is deleted in…
Name : Recombinant Human DMP1 Protein (His Tag)Biological Activity : Background : Dentin matrix acidic phosphoprotein (DMP1) is an extracellular matrix protein and a member of the small integrin binding…
Name : Recombinant Human DMBT1 Protein (His Tag)Biological Activity : Background : Deleted in malignant brain tumors 1 protein, also known as glycoprotein 34, surfactant pulmonary-associated D-binding protein, DMBT1 and…
Name : Recombinant Human DLST Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No. : NP_001924.2NCBI…
Name : Recombinant Human DLL4 Protein, HPLC-verifiedBiological Activity : Background : Delta-like protein 4 (DLL4, Delta4), a type I membrane-bound Notch ligand, is one of five known Notch ligands in…
Name : Recombinant Human DLL4 Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Delta-like protein 4 (DLL4, Delta4), a type I membrane-bound Notch ligand, is one of…
Name : Recombinant Human DLL4 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Delta-like protein 4 (DLL4, Delta4), a type I membrane-bound Notch ligand, is one of five known Notch…
Name : Recombinant Human DLL4 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : Delta-like protein 4 (DLL4, Delta4), a type I membrane-bound Notch ligand, is one of five known…
Name : Recombinant Human DLL1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Delta-like protein 1(DLL1), also known as Delta1, a single-pass type I membrane protein which contains one DSL…
Name : Recombinant Human DLL1 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : Delta-like protein 1(DLL1), also known as Delta1, a single-pass type I membrane protein which contains one…
Name : Recombinant Canine IL-11RA/IL-11R alpha Protein (His Tag)Biological Activity : Background : Interleukin 11 receptor, alpha subunit (IL11RA/IL-11RA) is a subunit of the interleukin 11 receptor which is a…
Name : Recombinant Human DLAT Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No. : NP_001922.2NCBI…
Name : Recombinant Human DKKL1 Protein (hFc Tag)Biological Activity : Background : Dickkopf-like 1 (DKKL1) or soggy 1, is a glycoprotein unique to mammals that is expressed primarily in developing…
Name : Recombinant Human DKK-3 Protein, HPLC-verifiedBiological Activity : Background : DKK3 (dickkopf related protein 3) is a member of the dickkopf-related family consisting of DKK1, DKK2, DKK3 and DKK4.…
Name : Recombinant Human DKK-1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Dickkopf (DKK) family proteins, consisting of DKK-1, DKK-2, DKK-3 and DKK-4, function as secreted Wnt antagonists by…
Name : Recombinant Human DKK-1 Protein (hFc Tag)Biological Activity : Background : Dickkopf (DKK) family proteins, consisting of DKK-1, DKK-2, DKK-3 and DKK-4, function as secreted Wnt antagonists by inhibiting…
Name : Recombinant Human DHRS9 Protein (His Tag)Biological Activity : Background : Dehydrogenase/reductase (SDR family) member 9 (DHRS9) is aberrantly expressed in colorectal cancer (CRC), the decreased expression of DHRS9…
Name : Recombinant Human Desmoglein-2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Desmoglein-2 (DSG2) is a specific cadherin of the cell-cell contact in cardiac desmosomes. Mutations in the DSG2-gene…
Name : Recombinant Human Desmocollin 2/DSC2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : DSC2 is a calcium-dependent glycoprotein that is a member of the desmocollin subfamily of the cadherin…
Name : Recombinant Human Desmocollin 2/DSC2 Protein (His Tag)Biological Activity : Background : DSC2 is a calcium-dependent glycoprotein that is a member of the desmocollin subfamily of the cadherin superfamily.…
Name : Recombinant Human Dermcidin Protein (hFc Tag)Biological Activity : Background : Hepatocellular carcinoma (HCC) is a major contributor to cancer-related deaths due to its often late stage diagnosis, and dermcidin (DCD)…
Name : Recombinant Canine IL-11RA/IL-11R alpha Protein (hFc Tag)Biological Activity : Background : Interleukin 11 receptor, alpha subunit (IL11RA/IL-11RA) is a subunit of the interleukin 11 receptor which is a…
Name : Recombinant Human DEP-1 Protein (aa 997-1337, His Tag)Biological Activity : Background : DEP1 / PTPRJ (Receptor-type tyrosine-protein phosphatase eta) is a member of the protein tyrosine phosphatase (PTP)…
Name : Recombinant Human Defensin alpha 3/DEFA3 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant Human DEFB127 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_001123244.1NCBI…
Name : Recombinant Human DEFB119 Protein (mFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_695021.2NCBI…
Name : Recombinant Human Dectin-2/CLEC6A Protein (ECD, His Tag)Biological Activity : Background : C-type lectin domain family 4 member N (CLEC4N), also known as Dectin-2, is a C-type lectin expressed…
Name : Recombinant Human Dectin-2/CLEC6A Protein (hFc Tag)Biological Activity : Background : C-type lectin domain family 4 member N (CLEC4N), also known as Dectin-2, is a C-type lectin expressed by…
Name : Recombinant Human Dectin-1/CLEC7A ProteinBiological Activity : Background : Dectin-1 was recently identified as the most important receptor for beta-glucan. It is a type II transmembrane protein which binds…
Name : Recombinant Human Dectin-1/CLEC7A Protein (mFc Tag), HPLC-verifiedBiological Activity : Background : Dectin-1 was recently identified as the most important receptor for beta-glucan. It is a type II transmembrane…
Name : Recombinant Human Dectin-1/CLEC7A Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : Dectin-1 was recently identified as the most important receptor for beta-glucan. It is a type II transmembrane…
Name : Recombinant Human Decorin ProteinBiological Activity : Background : Decorin is a ubiquitous small cellular or pericellular matrix proteoglycan and is closely related in structure to biglycan protein. It…
Name : Recombinant Canine IL-8/CXCL8 ProteinBiological Activity : Background : Interleukin 8 (IL-8), also known as CXCL8, which is a chemokine with a defining CXC amino acid motif that was…
Name : Recombinant Human Decorin Protein (His Tag)Biological Activity : Background : Decorin is a ubiquitous small cellular or pericellular matrix proteoglycan and is closely related in structure to biglycan…
Name : Recombinant Human Decorin Protein (hFc Tag)Biological Activity : Background : Decorin is a ubiquitous small cellular or pericellular matrix proteoglycan and is closely related in structure to biglycan…
Name : Recombinant Human LY75/CD205 Protein (ECD, His Tag)Biological Activity : Background : LY75 (Lymphocyte Antigen 75) is a Protein Coding gene. It is broadly expressed in the lymph node,…
Name : Recombinant Human DDR2 Protein (aa 422-855, His & GST Tag)Biological Activity : Background : Discoidin domain receptor 2 (DDR2) or CD167b (cluster of differentiation 167b) is a kind…
Name : Recombinant Human DDR2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Discoidin domain receptor 2 (DDR2) or CD167b (cluster of differentiation 167b) is a kind of protein tyrosine…
Name : Recombinant Human DDR2 Protein (hFc Tag)Biological Activity : Background : Discoidin domain receptor 2 (DDR2) or CD167b (cluster of differentiation 167b) is a kind of protein tyrosine kinases…
Name : Recombinant Human DDR1 Protein (aa 444-913, His & GST Tag)Biological Activity : Background : Discoidin domain receptor family, member 1 (DDR1), also known as or CD167a (cluster of…
Name : Recombinant Human DDR1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Discoidin domain receptor family, member 1 (DDR1), also known as or CD167a (cluster of differentiation 167a), and…
Name : Recombinant Human DDOST ProteinBiological Activity : Background : The enzyme oligosaccharyltransferase (dolichyl-diphosphooligosaccharide-protein glycosyltransferase) (DDOST), or 48-kDa subunit (OST48) is one of the catalytic subunits in this complex, exerts…
Name : Recombinant Human DOPA Decarboxylase/DDC Protein (His Tag), HPLC-verifiedBiological Activity : Background : Dopa Decarboxylase (DDC), also known as AADC and Aromatic-L-amino acid decarboxylase, is a 54 kDa member…
Name : Recombinant Canine IL-6R Protein (ECD, His Tag)Biological Activity : Background : Interleukin 6 receptor (IL-6R) also known as CD126 (Cluster of Differentiation 126) is a type I cytokine…
Name : Recombinant Human DCXR Protein (His Tag)Biological Activity : Background : DCXR, also known as HCR2, belongs to the short-chain dehydrogenases/reductases (SDR) family. It is highly expressed in kidney,…
Name : Recombinant Human DCUN1D2 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : E. coliTag : Protein Accession No. : NP_001014305.1NCBI…
Name : Recombinant Human DCUN1D1 Protein (His Tag)Biological Activity : Background : DCUN1D1, also known as SCCRO, is part of an E3 ubiquitin ligase complex for neddylation. DCUN1D1 functions to…
Name : Recombinant Human DcR3/TNFRSF6B Protein (hFc Tag)Biological Activity : Background : Tumor necrosis factor receptor superfamily member 6B (TNFRSF6B) also known as DcR3(Decoy Receptor 3) and M68 is the…
Name : Recombinant Human DcR2/TRAIL R4 Protein (His Tag)Biological Activity : Background : Tumor necrosis factor receptor superfamily member 10D (TNFRSF10D), also known as TNF-related apoptosis-inducing ligand receptor 4 (TRAIL…
Name : Recombinant Human DcR2/TRAIL R4 Protein (ECD, hFc Tag)Biological Activity : Background : Tumor necrosis factor receptor superfamily member 10D (TNFRSF10D), also known as TNF-related apoptosis-inducing ligand receptor 4…
Name : Recombinant Human DcR1/TRAILR3 Protein (His Tag)Biological Activity : Background : TNFRSF10C CNV in patients with CRC is associated with distant metastatic disease. A high frequency of CGI methylation…
Name : Recombinant Human DCLK1 ProteinBiological Activity : Background : DCAMKL1, also known as DCLK1, is a member of the protein kinase superfamily and the doublecortin family. It contains two…
Name : Recombinant Human DCLK1 Protein (aa 1-705, His & GST Tag)Biological Activity : Background : DCAMKL1, also known as DCLK1, is a member of the protein kinase superfamily and…
Name : Recombinant Human DCBLD2 Protein (His Tag)Biological Activity : Background : DCBLD2, also known as ESDN and CLCP1, localizes in various compartments. DCBLD2 is up-regulated in lung cancers and…
Name : Recombinant Canine IL-5 Protein (His Tag)Biological Activity : Background : Interleukin 5 (IL-5) is a member of the interleukin family with a length of 115 amino acids. Interleukins…
Name : Recombinant Human DCBLD1 Protein (His Tag)Biological Activity : Background : Discoidin, also known as DCBLD1, contains 1 CUB domain, 1 F5/8 type C domain and 1 LCCL domain.…
Name : Recombinant Human DC-SIGN/CD209 Protein (hFc Tag)Biological Activity : Background : Dendritic cell (DC)-specific intercellular adhesion molecule 3 (ICAM-3) grabbing nonintegrin (DC-SIGN), also known as CD209, is a type…
Name : Recombinant Human DBT Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No. : NP_001909.3NCBI…
Name : Recombinant Human DBI Protein (His Tag)Biological Activity : Background : The diazepam binding inhibitor (DBI), alternatively known as the acyl-CoA binding protein (ACBP), is involved in multiple biological…
Name : Recombinant Human DARS Protein (His Tag)Biological Activity : Background : Aspartate tRNA ligase 1, also known as DARS, is part of a multienzyme complex of aminoacyl-tRNA synthetases. It…
Name : Recombinant Human DAPK1 Protein (aa 1-363, His & GST Tag)Biological Activity : Background : Death-associated protein kinase 1, also known as DAP kinase 1, DAPK1 and DAPK, is…
Name : Recombinant Human DAP10 Protein (mFc Tag)Biological Activity : Background : HCST (Hematopoietic Cell Signal Transducer, also known as DAP1) is a Protein Coding gene. HCST belongs to the…
Name : Recombinant Human Dystroglycan 1/DAG1 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human Cytoglobin Protein (His Tag)Biological Activity : Background : Cytoglobin, also known as CYGB, is aglobinmolecule ubiquitously expressed in all tissues and most notably utilized in marine…
Name : Recombinant Human CYTL1 Protein (mFc Tag)Biological Activity : Background : Cytokine-like protein 1 (CYTL1) is a small widely expressed secreted protein lacking significant primary sequence homology to any…
Name : Recombinant Canine IL-4 ProteinBiological Activity : Background : Interleukin-4, also known as IL4, is a secreted protein that belongs to the IL-4 / IL-13 family. Interleukin-4 / IL4…
Name : Recombinant Human Cystatin SN Protein (His Tag), HPLC-verifiedBiological Activity : Background : Cystatin-SN, also known as Cystain-SA-I, Cystatin-1, Salivary cystatin-SA-1 and CST1, is a secreted protein which belongs…
Name : Recombinant Human Cystatin SA Protein (His Tag)Biological Activity : Background : Cystatin-SA, also known as Cystatin-2, Cystatin-S5 and CST2, is a secreted protein which belongs to thecystatin family.…
Name : Recombinant Human Cystatin S Protein (His Tag)Biological Activity : Background : Cystatin-S, also known as Cystatin-4, Salivary acidic protein 1, Cystatin-SA-III and CST4, is a secreted protein which…
Name : Recombinant Human Cystatin F/CST7 ProteinBiological Activity : Background : The cystatin superfamily members are important natural cysteine protease inhibitors present in a wide variety of organisms and are…
Name : Recombinant Human Cystatin F/CST7 Protein (His Tag)Biological Activity : Background : The cystatin superfamily members are important natural cysteine protease inhibitors present in a wide variety of organisms…
Name : Recombinant Human Cystatin F/CST7 Protein (hFc Tag)Biological Activity : Background : The cystatin superfamily members are important natural cysteine protease inhibitors present in a wide variety of organisms…
Name : Recombinant Human Cystatin D Protein (His Tag)Biological Activity : Background : Cystatins are natural inhibitors of papain-like (family C1) and legumain-related (family C13) cysteine peptidases. The mammalian cystatin…
Name : Recombinant Human Cystatin C Protein, HPLC-verifiedBiological Activity : Background : Cystatin C, also known as Cystatin-3 (CST3) is a secreted type 2 cysteine protease inhibitor synthesized in all…
Name : Recombinant Human Cystatin C Protein (His Tag)Biological Activity : Background : Cystatin C, also known as Cystatin-3 (CST3) is a secreted type 2 cysteine protease inhibitor synthesized in…
Name : Recombinant Human Cystatin B Protein (His Tag)Biological Activity : Background : Cystatin-B, also known as CPI-B, Liver thiol proteinase inhibitor, Stefin-B, CSTB and CST6, is a cytoplasm and…
Name : Recombinant Canine IL-33 ProteinBiological Activity : Background : Interleukin 33 (IL-33), also known as DVS27 or NF-HEV (Nuclear Factor from High Endothelial Venules), is a pro-inflammatory protein and…
Name : SARS-CoV-2 (2019-nCoV) Spike S1+S2 ECD (R683A, R685A, F817P, A892P, A899P, A942P, K986P, V987P)-His Recombinant Protein (HPLC-verified)Biological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions…
Name : Recombinant Human Cystatin A Protein (His Tag)Biological Activity : Background : Cystatin-A, also known as Cystatin-AS, Stefin-A and CSTA, is a cytoplasm protein which belongs to thecystatin family.…
Name : Recombinant Human CYP3A4 Protein (His Tag)Biological Activity : Background : CYP3A4 is an important member of the cytochrome P450 enzyme superfamily, with 33 allelic variants. Human cytochrome P450…
Name : Recombinant Human, Cynomolgus, Rhesus CD28 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : CD28 (Cluster of Differentiation 28) is a disulphide-bonded glycoprotein belonging to…
Name : Recombinant Human, Cynomolgus, Rhesus CD28 Protein (ECD, mFc Tag), HPLC-verifiedBiological Activity : Background : CD28 (Cluster of Differentiation 28) is a disulphide-bonded glycoprotein belonging to the immunoglobulin (Ig)…
Name : Recombinant Human Cyclophilin F Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human Cyclophilin B Protein (His Tag)Biological Activity : Background : PPIB is identified as a candidate gene for OI-IX. Osteogenesis imperfecta (OI) is an inherited disorder of…
Name : Recombinant Human Cyclophilin A Protein (His Tag), HPLC-verifiedBiological Activity : Background : Peptidyl-prolyl cis-trans isomerase A, also known as PPIase A, Rotamase A, Cyclophilin A, Cyclosporin A-binding protein,…
Name : Recombinant Human Cyclin E Protein (His & GST Tag)Biological Activity : Background : Cyclin E1 is a member of the highly conserved cyclin family and belongs to the…
Name : Recombinant Human Cyclin E Protein (His Tag)Biological Activity : Background : Cyclin E1 is a member of the highly conserved cyclin family and belongs to the E-type cyclin…
Name : Recombinant Human Cyclin A1 Protein (His Tag)Biological Activity : Background : Cyclin A1 is a member of the highly conserved cyclin family that is characterized by a dramatic…
Name : Recombinant Canine IL-1 beta ProteinBiological Activity : Background : Interleukin-1 beta (IL1 beta or IL1B) also known as catabolin, is a member of the interleukin 1 cytokine family.…
Name : Recombinant Human CYB5R1 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : E. coliTag : Protein Accession No. : Q9UHQ9NCBI…
Name : Human CXCR4/CD184 (Full Length) Protein-VLPBiological Activity : Background : Biological Activity : Immobilized Human CXCR4/CD184 (Full Length) Protein-VLP(cat:11325-HNAH) at 5 μg/mL (100 μL/well) can bind Anti-Human CXCR4/CD184 Antibody, Human…
Name : Recombinant Human CXCL7/NAP-2 Protein (His Tag)Biological Activity : Background : Pro-platelet basic protein (PPBP) is also known as Chemokine (C-X-C motif) ligand 7 (CXCL7) and nucleosome assembly protein…
Name : Recombinant Human CXCL5 ProteinBiological Activity : Background : CXCL5 is a small cytokine belonging to the CXC chemokine family. CXC chemokines are particularly significant for leukocyte infiltration in…
Name : Recombinant Human CXCL4/PF4 ProteinBiological Activity : Background : Platelet factor 4 (PF4), also known as chemokine (C-X-C motif) ligand 4 (CXCL4), is a small cytokine belonging to the…
Name : Recombinant Human CXCL17 Protein (His Tag)Biological Activity : Background : Chemokine (C-X-C motif) ligand 17 (CXCL17) is the latest member of the chemokine family. CXCL17 is a potential…
Name : Recombinant Human CXCL16 Protein (His Tag)Biological Activity : Background : C-X-C motif chemokine 16, also known as Small-inducible cytokine B16, SR-PSOX, and CXCL16, is a single-pass type I…
Name : Recombinant Human BRAK/CXCL14 Protein, Amine-Labeled BiotinylatedBiological Activity : Background : CXCL14 is a CXC chemokine family that exhibits antimicrobial activity and contains an amphipathic cationic alpha-helical region in…
Name : Recombinant Human BRAK/CXCL14 ProteinBiological Activity : Background : CXCL14 is a CXC chemokine family that exhibits antimicrobial activity and contains an amphipathic cationic alpha-helical region in the C-terminus,…
Name : Recombinant Human BRAK/CXCL14 Protein (His Tag)Biological Activity : Background : CXCL14 is a CXC chemokine family that exhibits antimicrobial activity and contains an amphipathic cationic alpha-helical region in…
Name : Recombinant Canine IGFBP5 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : CanineSource : HEK293 CellsTag : Protein Accession No. : XP_038303831.1NCBI…
Name : Recombinant Human CXCL11 ProteinBiological Activity : Background : I-TAC, also known as CXCL11, is a small cytokine belonging to the CXC chemokine family. It is highly expressed in…
Name : Recombinant Human CXCL1 ProteinBiological Activity : Background : The Chemokine (C-X-C motif) Ligand 1, CXCL1, is a small cytokine belonging to the CXC chemokine family that was previously…
Name : Recombinant Human CXCL1 Protein (His & SUMO Tag)Biological Activity : Background : The Chemokine (C-X-C motif) Ligand 1, CXCL1, is a small cytokine belonging to the CXC chemokine…
Name : Recombinant Human CXCL1 Protein (His & NusA Tag)Biological Activity : Background : The Chemokine (C-X-C motif) Ligand 1, CXCL1, is a small cytokine belonging to the CXC chemokine…
Name : Recombinant Human CUTC Protein (His Tag)Biological Activity : Background : Copper homeostasis protein cutC homolog, also known as CGI-32 and CUTC, is a cytoplasm and nucleus protein which…
Name : Recombinant Human CTRL Protein (His Tag)Biological Activity : Background : CTRL-1, also known as chymotrypsin-like protease, belongs to thepeptidase S1 family. CTRL-1 contains 1peptidase S1 domain. Its expression…
Name : Recombinant Human CTLA-4 Protein, HPLC-verifiedBiological Activity : Background : Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane protein and a…
Name : Recombinant Human CTLA-4 Protein (ECD, hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass…
Name : Recombinant Human CTLA-4 Protein (rFc Tag)Biological Activity : Background : Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane protein and…
Name : Recombinant Human CTLA-4 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane…
Name : Recombinant Canine IGFBP1 Protein (His Tag)Biological Activity : Background : IGFBP1, also known as IGFBP-1 and insulin-like growth factor-binding protein 1, is a member of the insulin-like growth…
Name : Recombinant Human CTLA-4 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane protein…
Name : Recombinant Human CTLA-4 Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane protein…
Name : Recombinant Human CTHRC1 Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Collagen triple helix repeat-containing protein 1, also known as Protein NMTC1, and CTHRC1, is…
Name : Recombinant Human CTHRC1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Collagen triple helix repeat-containing protein 1, also known as Protein NMTC1, and CTHRC1, is a secreted protein…
Name : Recombinant Human CTHRC1 Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : Collagen triple helix repeat-containing protein 1, also known as Protein NMTC1, and CTHRC1, is a secreted protein…
Name : Recombinant Human Integrin alpha V beta 8 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag :…
Name : Recombinant Human Integrin alpha V beta 3 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag :…
Name : Recombinant Human CSTL1 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : AAI17397.1NCBI…
Name : Recombinant Human CST9L Protein (hFc Tag)Biological Activity : Background : Testatin is a member of the Cystatin family. Cystatins comprise genes that all show expression patterns that are…
Name : Recombinant Human CST8 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_005483.1NCBI…
Name : Recombinant Canine HGF ProteinBiological Activity : Background : Hepatocyte growth factor, also known as HGF, contains 4 kringle domains, 1 PAN domain, and 1 peptidase S1 domain. It…
Name : Recombinant Human CST6 Protein (His Tag)Biological Activity : Background : Cystatin E/M, also referred to as CST6, is a member of type 2 cysteine proteinase inhibitors of the…
Name : Recombinant Human CSRP1 Protein (His Tag)Biological Activity : Background : Cysteine and glycine-rich protein 1, also known as Cysteine-rich protein 1, CSRP1 and CSRP, is a member of…
Name : Recombinant Human CSNK2A2 ProteinBiological Activity : Background : Casein kinase II subunit alpha', also known as CSNK2A2 and CK2A2, is a member of the protein kinase superfamily, Ser/Thr…
Name : Recombinant Human CSNK2A2 Protein (His & GST Tag)Biological Activity : Background : Casein kinase II subunit alpha', also known as CSNK2A2 and CK2A2, is a member of the…
Name : Recombinant Human Casein Kinase 1 gamma 2 Protein (His Tag)Biological Activity : Background : Casein kinase I gamma 2 isoform (CSNK1G2), a member of the large casein kinase…
Name : Recombinant Human CSNK1G1 Protein (His & GST Tag)Biological Activity : Background : Casein kinase I isoform gamma-1, also known as CSNK1G1, is a member of the protein kinase…
Name : Recombinant Human CSK Protein (GST Tag)Biological Activity : Background : The tyrosine kinase c-Src has been implicated as a modulator of cell proliferation, spreading, and migration. These functions…
Name : Recombinant Human Placental Lactogen/CSH1 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Chorionic somatomammotropin hormone, also known as Choriomammotropin, Lactogen, Placental lactogen and CSH1, is a secreted…
Name : Recombinant Human Placental Lactogen/CSH1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Chorionic somatomammotropin hormone, also known as Choriomammotropin, Lactogen, Placental lactogen and CSH1, is a secreted protein…
Name : Recombinant Human CSF3R/G-CSFR Protein (His Tag), HPLC-verifiedBiological Activity : Background : Granulocyte Colony Stimulating Factor Receptor (G-CSFR), also known as CD114, which belongs to the cytokine receptor superfamily,…
Name : Recombinant Canine Her2/ERBB2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Human epidermal growth factor receptor 2 (HER2), also known as ErbB2, NEU, and CD340, is a type…
Name : Recombinant Human CSF3R/G-CSFR Protein (hFc Tag)Biological Activity : Background : Granulocyte Colony Stimulating Factor Receptor (G-CSFR), also known as CD114, which belongs to the cytokine receptor superfamily, is…
Name : Recombinant Human M-CSFR/CSF1R ProteinBiological Activity : Background : M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R), a cytokine involved in the…
Name : Recombinant Human M-CSFR/CSF1R ProteinBiological Activity : Background : M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R), a cytokine involved in the…
Name : Recombinant Human M-CSFR/CSF1R Protein (His & AVI Tag), BiotinylatedBiological Activity : Background : M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R),…
Name : Recombinant Human M-CSFR/CSF1R Protein (hFc & AVI Tag), BiotinylatedBiological Activity : Background : M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R),…
Name : Recombinant Human M-CSFR/CSF1R Protein (mFc Tag)Biological Activity : Background : M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R), a cytokine involved…
Name : Recombinant Human M-CSFR/CSF1R Protein (His & GST Tag)Biological Activity : Background : M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R), a…
Name : Recombinant Human M-CSFR/CSF1R Protein (ECD, His Tag)Biological Activity : Background : M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R), a cytokine…
Name : Recombinant Human M-CSFR/CSF1R Protein (Domain I&II&III, His Tag)Biological Activity : Background : M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R), a…
Name : Recombinant Human M-CSFR/CSF1R Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R), a…
Name : Recombinant Canine HE4/WFDC2 Protein (hFc Tag)Biological Activity : Background : WAP four-disulfide core domain protein 2, also known as Epididymal secretory protein E4, Major epididymis-specific protein E4, Putative…
Name : Recombinant Human M-CSFR/CSF1R Protein (ECD, hFc Tag)Biological Activity : Background : M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R), a cytokine…
Name : Recombinant Human CSEN Protein (His Tag)Biological Activity : Background : KCNIP3 (Potassium Voltage-Gated Channel Interacting Protein 3, also known as CSEN) is a Protein Coding gene. CSEN is…
Name : Recombinant Human CSAG1 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : AAH59947.1NCBI…
Name : Recombinant Human CRTAM Protein (His Tag)Biological Activity : Background : Cytotoxic and regulatory T-cell molecule, also known as Class-I MHC-restricted T-cell-associated molecule and CRTAM, is a single-pass type…
Name : Recombinant Human CROT Protein (474 Leu/Val, His Tag)Biological Activity : Background : Carnitine octanoyltransferase (CROT or COT), also known as octanoyl-CoA: L-carnitine O-octanoyltransferase, medium-chain/long-chain carnitine acyltransferase, and carnitine…
Name : Recombinant Human CRLF2/TSLPR Protein (His Tag), HPLC-verifiedBiological Activity : Background : Overexpression of cytokine receptor-like factor 2 (CRLF2) due to chromosomal rearrangement has been observed in acute lymphoblastic…
Name : Recombinant Human CRLF2/TSLPR Protein (ECD, hFc Tag)Biological Activity : Background : Overexpression of cytokine receptor-like factor 2 (CRLF2) due to chromosomal rearrangement has been observed in acute lymphoblastic…
Name : Recombinant Human CRISP3 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : P54108.1NCBI…
Name : Recombinant Human Cripto Protein (His Tag)Biological Activity : Background : Cripto/TDGF1 is a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family. EGF-CFC family…
Name : Recombinant Human Cripto Protein (hFc Tag)Biological Activity : Background : Cripto/TDGF1 is a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family. EGF-CFC family…
Name : Recombinant Canine GUCY2C/Guanylyl cyclase C Protein (ECD, His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : CanineSource : HEK293 CellsTag : Protein Accession…
Name : Recombinant Human CRIPT Protein (His Tag)Biological Activity : Background : CRIPT, also known as cysteine-rich PDZ-binding protein, belongs to the CRIPT family. It interacts with TUBB1. CRIPT also…
Name : Recombinant Human CRIP2 ProteinBiological Activity : Background : CRIP2 is a putative transcription factor. It has a widespread tissue expression and is highly expressed in heart. CRIP2 contains…
Name : Recombinant Human CRIP2 Protein (His & GST Tag)Biological Activity : Background : CRIP2 is a putative transcription factor. It has a widespread tissue expression and is highly expressed…
Name : Recombinant Human CRELD1 Protein (His Tag)Biological Activity : Background : CRELD1 is a transmembrane glycoprotein. Epidermal growth factor(EGF)like domain exists in CRELD1. EGF-like repeats are a class of…
Name : Recombinant Human CREG1 Protein (His Tag)Biological Activity : Background : CREG1 belongs to the CREG family. It is a adenovirus E1A protein which both activates and represses gene…
Name : Recombinant Human CREB3L1 Protein (aa 396-519, His Tag)Biological Activity : Background : CREB3L1, also known as OASIS, is a cellular transcription factor synthesized as a membrane-bound precursor. It…
Name : Recombinant Human Creatine Kinase Muscle/CKM ProteinBiological Activity : Background : CKM, also known as CK-MM, is mainly expressed in skeletal muscle. As the primary CK isoenzyme, it also…
Name : Recombinant Human Creatine kinase B-type/CKB Protein (His Tag)Biological Activity : Background : CKB(Creatine kinase B type) contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain.…
Name : Recombinant Human CRBN & DDB1 Heterodimer Protein (His & FLAG Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag :…
Name : Recombinant Human CRABP2 Protein (His Tag)Biological Activity : Background : Cellular retinoic acid-binding protein 2, also known as Cellular retinoic acid-binding protein II, CRABP-II and CRABP2, is a…
Name : Recombinant Canine Glypican 3/GPC3 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Glypican-3, also known as Intestinal protein OCI-5, GPC3, and OCI5, is a member of the glypican…
Name : Recombinant Human CRABP1 ProteinBiological Activity : Background : CRABP1 is a specific binding protein for a vitamin A family member. It is thought that CRABP1 plays an important…
Name : Recombinant Human CPVL Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : AAH16838.1NCBI…
Name : Recombinant Human CPNE1 ProteinBiological Activity : Background : Copine I, also known as CPN1, is a member of the copine family. Copine I is a calcium-dependent membrane-binding protein…
Name : Recombinant Human CPNE1 Protein (SUMO Tag)Biological Activity : Background : Copine I, also known as CPN1, is a member of the copine family. Copine I is a calcium-dependent…
Name : Recombinant Human Cpn10/HSPE1 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : E. coliTag : Protein Accession No. : NP_002148.1NCBI…
Name : Recombinant Human CPLX3 Protein (His Tag)Biological Activity : Background : CPLX3, also known as complexin 3, belongs to the complexin/synaphin family. As a SNARE-binding protein, complexin (CPX), can…
Name : Recombinant Human CPLX2 Protein (His Tag)Biological Activity : Background : Complexin-2 (CPLX2), a member of the complexin/synaphin family, is a soluble pre-synaptic protein believed to regulate neurotransmitter release…
Name : Recombinant Human Carboxypeptidase B2 Protein (His Tag)Biological Activity : Background : Carboxypeptidase B2, also known as Carboxypeptidase U, Thrombin-activable fibrinolysis inhibitor, Plasma Carboxypeptidase B, CPB2, is a secreted…
Name : Recombinant Human Carboxypeptidase B1 Protein (His Tag)Biological Activity : Background : Carboxypeptidase B1, also well known as pancreatic proCarboxypeptidase B (PCPB), is a highly pancreas -specific protein (PASP),…
Name : Recombinant Human Carboxypeptidase A2 Protein (His Tag)Biological Activity : Background : Carboxypeptidase A2 ( CPA2 ) is a secreted pancreatic procarboxy -peptidase, and cleaves the C-terminal amide or…
Name : Recombinant Canine GFR Alpha-1/GFRA1 Protein (His Tag)Biological Activity : Background : Glial cell line derived neurotrophic factor (GDNF) Family Receptor Alpha 1 (GFRA1) is a member of the…
Name : Recombinant Human COX5B Protein (His Tag)Biological Activity : Background : Cytochrome C oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme…
Name : Recombinant Human COX4NB Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : E. coliTag : Protein Accession No. : O43402NCBI…
Name : Recombinant Human Cyclooxygenase-2/COX-2 Protein (His Tag)Biological Activity : Background : PTGS2, also known as COX-2, is s component of Prostaglandin-endoperoxide synthase (PTGS). PTGS, also known as cyclooxygenase, is…
Name : Recombinant Human COQ7 Protein (His Tag)Biological Activity : Background : Ubiquinone biosynthesis protein COQ7 homolog, also known as Coenzyme Q biosynthesis protein 7 homolog, Timing protein clk-1 homolog…
Name : Recombinant Human Contactin 3 Protein (708 Asp/Asn, His Tag)Biological Activity : Background : Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively…
Name : Recombinant Human Contactin 3 Protein (708 Asp/Asn, hFc Tag)Biological Activity : Background : Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively…
Name : Recombinant Human Contactin-1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the…
Name : Recombinant Human COMT Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No. : NP_000745.1NCBI…
Name : Recombinant Human Complement component 3 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession…
Name : Recombinant Human COMP Protein (His Tag)Biological Activity : Background : Cartilage Oligomeric Matrix Protein (COMP), also referred to as Thrombospondin-5, is a non-collagenous extracellular matrix (ECM) protein and…
Name : Recombinant Canine GDNF Protein (hFc Tag)Biological Activity : Background : Glial cell line-derived neurotrophic factor(GDNF) is an important member of the GDNF family of ligands(GFL). The GDNF family…
Name : SARS-CoV-2 (2019-nCoV) Spike S1+S2 ECD (HV69-70 deletion, Y144 deletion, N501Y, A570D, D614G, P681H, T716I, S982A, D1118H)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses…
Name : Recombinant Human COMMD9 Protein (His Tag)Biological Activity : Background : COMMD9 is a COMM domain-containing or COMMD protein. COMMD family is comprised of ten members which are widely…
Name : Recombinant Human COMMD8 Protein (His Tag)Biological Activity : Background : COMMD8 is a member of the COMMD family. Members of this family are a group of evolutionary conserved…
Name : Recombinant Human Collagen II/COL2A1 Protein (aa 1242-1487, His Tag)Biological Activity : Background : COL2A1 is the alpha-1 chain of type II collagen which is a fibrillar collagen found…
Name : Recombinant Human COL9A1 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : P20849-3NCBI…
Name : Recombinant Human COL9A1 Protein (mFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : P20849-3NCBI…
Name : Recombinant Human COL6A3 Protein, HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_004360.2NCBI Gene…
Name : Recombinant Human COL6A3 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : P12111-1NCBI…
Name : Recombinant Human COL5A2 Protein (mFc Tag)Biological Activity : Background : COL5A2 is a component of type V collagen. It is known as the pro-alpha2(V) chain. COL5A2, together with…
Name : Recombinant Human COL4A3BP Protein (His & GST Tag)Biological Activity : Background : COL4A3BP is a member of the StarD2 subfamily. It contains a pleckstrin homology domain at its…
Name : Recombinant Human Cofilin 2 Protein (His Tag)Biological Activity : Background : Cofilin 2 (muscle), also known as CFL2, is a member of cofilin family of the actin-binding protein…
Name : Recombinant Canine Fractalkine/CX3CL1 ProteinBiological Activity : Background : Fractalkine or Chemokine (C-X3-C motif) ligand 1 (CX3CL1) is a member of the CX3C chemokine family. Fractalkine / CX3CL1 is…
Name : Recombinant Human Cofilin Protein (His Tag)Biological Activity : Background : CFL1, also known as n-cofilin, is a member of the ADF/Cofilin family. This family comprises three genes: CFL1,…
Name : Recombinant Human COCH Protein (His Tag)Biological Activity : Background : Cochlin, also known as COCH-5B2 and COCH, is a secreted protein that contains one LCCL domain and two…
Name : Recombinant Human COASY Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : E. coliTag : Protein Accession No. : Q13057-1NCBI…
Name : Recombinant Human CNTN6 Protein (hFc Tag)Biological Activity : Background : Copy number variations (CNVs) of the human CNTN6 gene caused by megabase-scale microdeletions or microduplications in the 3p26.3…
Name : Recombinant Human CNTN5 Protein (His Tag)Biological Activity : Background : Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed mainly in the nervous…
Name : Recombinant Human Contactin-4 Protein (His Tag)Biological Activity : Background : Contactin-4, abbreviated as CNTN4, is a brain-derived protein belonging to the immunoglobulin superfamily. It has been found high…
Name : Recombinant Human CNTFR Protein (His Tag)Biological Activity : Background : Ciliary neurotrophic factor (CNTF) is a member of the cytokine family. It is a polypeptide hormone that have…
Name : Recombinant Human CNTF Protein (His Tag)Biological Activity : Background : Ciliary neurotrophic factor (CNTF) is a member of the cytokine family. It is a polypeptide hormone that has…
Name : Recombinant Human CNPY4 Protein (His Tag)Biological Activity : Background : CNPY4 belongs to the canopy family. CNPY4 interacts with toll-like receptor 4 (TLR4) and plays a role in…
Name : Recombinant Human CNPY3 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_001998.1NCBI…
Name : Recombinant Canine Fractalkine/CX3CL1 Protein (His Tag)Biological Activity : Background : Fractalkine or Chemokine (C-X3-C motif) ligand 1 (CX3CL1) is a member of the CX3C chemokine family. Fractalkine /…
Name : Recombinant Human CNPY3 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_006577.2NCBI…
Name : Recombinant Human CNPY2 Protein (His Tag)Biological Activity : Background : CNPY2 is a novel MIR-interacting protein that enhances neurite outgrowth and increases myosin regulatory light chain. CNPY2 enhances…
Name : Recombinant Human CNKSR3 Protein (GST Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No. : Q6P9H4NCBI…
Name : Recombinant Human CNDP2 Protein (His Tag)Biological Activity : Background : Cytosolic non-specific dipeptidase, also known as CNDP dipeptidase 2, Glutamate carboxypeptidase-like protein 1, Peptidase A, CNDP2 and CN2,…
Name : Recombinant Human CNDP1 Protein (His Tag)Biological Activity : Background : CNDP1, also known as carnosine dipeptidase 1, glutamate carboxypeptidase-like protein 2 (CPGL-2) or carnosinase 1 (CN1), is a…
Name : Recombinant Human CMBL Protein (His Tag)Biological Activity : Background : Carboxymethylenebutenolidase (CMBL), also known as 4-carboxymethylenebut-2-en-4-olide lactonohydrolase, maleylacetate enol- lactonase, dienelactone hydrolase, and carboxymethylene butenolide hydrolase, is a…
Name : Recombinant Human Clusterin Protein (sCLU, His Tag)Biological Activity : Background : Clusterin, also known as complement-associated protein SP-40, Complement cytolysis inhibitor, Apolipoprotein J, Testosterone-repressed prostate message 2, Aging-associated…
Name : Recombinant Human Clusterin Protein (CLU34, His Tag)Biological Activity : Background : Clusterin, also known as complement-associated protein SP-40, Complement cytolysis inhibitor, Apolipoprotein J, Testosterone-repressed prostate message 2, Aging-associated…
Name : Recombinant Human CLSTN1 Protein (ECD, His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human CLPS Protein (His Tag), HPLC-verifiedBiological Activity : Background : Colipase belongs to the colipase family. Structural studies of the complex and of colipase alone have revealed…
Name : Recombinant Canine Fractalkine/CX3CL1 Protein (hFc Tag)Biological Activity : Background : Fractalkine or Chemokine (C-X3-C motif) ligand 1 (CX3CL1) is a member of the CX3C chemokine family. Fractalkine /…
Name : Recombinant Human CLM-9 ProteinBiological Activity : Background : CLM-9, also known as TREM4, is a receptor which belongs to the TREM family. The TREM family of receptors regulates…
Name : Recombinant Human CLM-9 Protein (His Tag)Biological Activity : Background : CLM-9, also known as TREM4, is a receptor which belongs to the TREM family. The TREM family of…
Name : Recombinant Human CLM-9 Protein (hFc Tag)Biological Activity : Background : CLM-9, also known as TREM4, is a receptor which belongs to the TREM family. The TREM family of…
Name : Recombinant Human CLK3 Protein (GST Tag)Biological Activity : Background : Dual specificity protein kinase CLK3, also known as CDC-like kinase 3, and CLK3, is a member of CMGC…
Name : Recombinant Human CLIC4 Protein (His Tag)Biological Activity : Background : Chloride intracellular channel protein 4, also known as Intracellular chloride ion channel protein p64H1 and CLIC4, is a…
Name : Recombinant Human CLIC1 Protein (His Tag)Biological Activity : Background : Members of the CLIC family are largely soluble proteins that possess the intriguing property of spontaneous insertion into…
Name : Recombinant Human CLEC4D Protein (His Tag)Biological Activity : Background : C-type lectin (CLEC) family is a type of carbohydrate-binding protein domain named lectin. C-type lectins are the most…
Name : Recombinant Human CLEC4C Protein (ECD, hFc Tag)Biological Activity : Background : C-type Lectin Domain Family 4 Member C (CLEC4C) is a transmembrane protein selectively expressed on plasmocytoid dendritic…
Name : Recombinant Human DICR/CLEC4A Protein (His Tag), HPLC-verifiedBiological Activity : Background : Dendritic cell immunoreceptor (DCIR), also known as C-type lectin domain family 4 member A (CLEC4A), C-type lectin…
Name : Recombinant Human DICR/CLEC4A Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : Dendritic cell immunoreceptor (DCIR), also known as C-type lectin domain family 4 member A (CLEC4A), C-type…
Name : Recombinant Canine FOLR1 Protein (His Tag)Biological Activity : Background : The protein encoded by FOLR1 gene is a member of the folate receptor family. Members of this gene…
Name : Recombinant Human CLEC2B Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : AAH05254.1NCBI…
Name : Recombinant Human CLL-1/CLEC12A Protein (AVI & Fc Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : CLEC12A is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of…
Name : Recombinant Human CLL-1/CLEC12A Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : CLEC12A is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family…
Name : Recombinant Human CLL-1/CLEC12A Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : CLEC12A is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share…
Name : Recombinant Human CLEC10A/CD301 Protein (ECD, hFc Tag)Biological Activity : Background : CLEC10A, also known as the macrophage galactose-type calcium-type lectins (MGLs; CD301) constitute a unique class of C-type…
Name : Recombinant Human CLEC-2 Protein (His Tag)Biological Activity : Background : CLEC1B, also known as CLEC2, is a C-type lectin-like receptor expressed in myeloid cells and NK cells. Natural…
Name : Recombinant Human CLEC-1 Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : CLEC1A, also known as CLEC-1, is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members…
Name : Recombinant Human Claudin-9 Protein (His & AVI Tag), Biotinylated, NanodiscBiological Activity : Background : Claudin-9 (CLDN9) belongs to the claudins family and is a transmembrane protein found in…
Name : Recombinant Human Claudin-6 Protein, Fluorescent,VLPBiological Activity : Background : Claudin-6 (CLDN6) belongs to the claudins family and is a transmembrane protein found in tight junctions with two extracellular…
Name : Recombinant Human Claudin-6 Protein, VLPBiological Activity : Background : Claudin-6 (CLDN6) belongs to the claudins family and is a transmembrane protein found in tight junctions with two extracellular…
Name : Recombinant Canine FOLR1 Protein (hFc Tag)Biological Activity : Background : The protein encoded by FOLR1 gene is a member of the folate receptor family. Members of this gene…
Name : Recombinant Human Claudin-6 Protein (His & FLAG Tag), NanodiscBiological Activity : Background : Claudin-6 (CLDN6) belongs to the claudins family and is a transmembrane protein found in tight…
Name : Recombinant Human Claudin-6 Protein (His & AVI Tag), Biotinylated, NanodiscBiological Activity : Background : Claudin-6 (CLDN6) belongs to the claudins family and is a transmembrane protein found in…
Name : Recombinant Human Claudin18 Protein (CLDN18.2), VLP, FluorescentBiological Activity : Background : Claudins family member Claudin18 (CLDN18) is a four-pass transmembrane protein with two extracellular loops and cytoplasmic N-…
Name : Human Claudin18.2-VLP (Full Length) ProteinBiological Activity : Background : Claudins family member Claudin18 (CLDN18) is a four-pass transmembrane protein with two extracellular loops and cytoplasmic N- and C-tails…
Name : Recombinant Human Claudin18 Protein (Nanodisc, Full Length, His & Strep Tag)Biological Activity : Background : Claudins family member Claudin18 (CLDN18) is a four-pass transmembrane protein with two extracellular…
Name : Recombinant Human Claudin18 Protein (CLDN18.1), VLPBiological Activity : Background : Claudins family member Claudin18 (CLDN18) is a four-pass transmembrane protein with two extracellular loops and cytoplasmic N- and…
Name : Recombinant Human Claudin-9 Protein (VLP, Full Length)Biological Activity : Background : Claudin-9 (CLDN9) belongs to the claudins family and is a transmembrane protein found in tight junctions with…
Name : Recombinant Human Claudin-6 Protein (Full-length, Nanodisc, Fluorescent, GFP & His Tag)Biological Activity : Background : Claudin-6 (CLDN6) belongs to the claudins family and is a transmembrane protein found…
Name : Recombinant Human Claudin-4/CLDN4 Protein (Nanodisc, Full Length, His & Strep Tag)Biological Activity : Background : CLDN4 (encoding claudin-4), a cell tight junction (TJ) protein, is highly expressed in…
Name : Recombinant Human Claudin-11 Protein (mFc Tag)Biological Activity : Background : Claudin-11, also known as CLDN11, belongs to the group of claudins. Claudins are integral membrane proteins and components…
Name : Recombinant Canine FGF-9 Protein (mFc Tag)Biological Activity : Background : Fibroblast growth factor 9 (FGF9) also known as Glia-activating factor or Heparin-binding growth factor 9, is a member…
Name : Recombinant Human CKMT1A Protein (His Tag)Biological Activity : Background : CKMT1A belongs to the ATP:guanido phosphotransferase family. It contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase…
Name : Recombinant Human Creatine kinase B-type/CKB ProteinBiological Activity : Background : CKB(Creatine kinase B type) contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. It belongs…
Name : Recombinant Human Creatine Kinase Muscle/CKM Protein (His Tag)Biological Activity : Background : CKM, also known as CK-MM, is mainly expressed in skeletal muscle. As the primary CK isoenzyme,…
Name : Recombinant Human CKAP1/TBCB Protein (His Tag)Biological Activity : Background : Tubulin-folding cofactor B, also known as TBCB, belongs to the TBCB family. It contains 1 CAP-Gly domain and…
Name : Recombinant Human CK2 alpha/CSNK2A1 Protein (GST Tag)Biological Activity : Background : Casein kinase II subunit alpha, also known as CK II alpha, CSNK2A1 and CK2A1, is a member…
Name : Recombinant Human CK-MB/CKMB ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : E. coliTag : Protein Accession No. : NCBI Gene ID…
Name : Recombinant Human Citrate Synthase Protein (His Tag)Biological Activity : Background : Chondroitin sulphate (CS) glycosaminoglycan chains on cell and extracellular matrix proteoglycans (PGs) can no longer be regarded…
Name : Recombinant Human CISD1 Protein (His Tag)Biological Activity : Background : Mitochondrial dysfunction is thought to play a significant role in neurodegeneration observed in Parkinson's disease (PD), the loss…
Name : Recombinant Human Cip4 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No. : NP_004231.1NCBI…
Name : Recombinant Human CIB2 Protein (His Tag)Biological Activity : Background : Calcium and integrin-binding protein 2 (CIB2) belongs to a protein family with four known members, CIB1 through CIB4,…
Name : Recombinant Canine FGF14 ProteinBiological Activity : Background : FGF14 is a member of the fibroblast growth factor (FGF) family. Members of this family possess broad mitogenic and cell…
Name : Recombinant Human cIAP1/BIRC2 Protein (AVI Tag)Biological Activity : Background : The cellular inhibitor of apoptosis protein-1 (cIAP1) is a member of the Inhibitor of Apoptosis family proteins are…
Name : Recombinant Human Chymotrypsin C Protein (His Tag)Biological Activity : Background : Chymotrypsin C (abbreviated for CTRC), also known as caldecrin or elastase4, is a digestive enzyme of the…
Name : Recombinant Human chymase 1/CMA1 Protein (His Tag)Biological Activity : Background : The STR polymorphism in the CMA1 gene is associated with asthma and that this association is even…
Name : Recombinant Human CHST9 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant Human CHST15 Protein (His Tag)Biological Activity : Background : Carbohydrate sulfotransferase 15, also known as N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase, GalNAc4S-6ST, B-cell RAG-associated gene protein, CHST15 and BRAG, is…
Name : Recombinant Human CHST11 Protein (His Tag)Biological Activity : Background : CHST11, also known as C4ST-1, belongs to the sulfotransferase 2 family. CHST11 localizes to the golgi membrane, and…
Name : Recombinant Human CHRNB3 Protein (ECD, His Tag)Biological Activity : Background : Cholinergic nicotinic receptor (CHRN) gene family has been known to mediate the highly additive effects of nicotine…
Name : Recombinant Human CHRNB3 Protein (ECD, hFc Tag)Biological Activity : Background : Cholinergic nicotinic receptor (CHRN) gene family has been known to mediate the highly additive effects of nicotine…
Name : Recombinant Human CHRNA5 Protein (His Tag)Biological Activity : Background : Genetic variation in the cluster on chromosome 15, encoding the nicotinic acetylcholine receptor subunits (CHRNA5-CHRNA3-CHRNB4), has shown strong…
Name : Recombinant Human Chorionic Gonadotropin/CGA ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_000726.1NCBI Gene…
Name : Recombinant Canine FGF12 ProteinBiological Activity : Background : FGF12 is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival…
Name : Recombinant Human Chorionic Gonadotropin/CGA Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human Chorionic Gonadotropin/CGA Protein (mFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human CHN1 ProteinBiological Activity : Background : CHN1, also known as chimerin 1, is a TPase-activating protein for ras-related p21-rac and a phorbol ester receptor. It is…
Name : Recombinant Human CHN1 Protein (His & GST Tag)Biological Activity : Background : CHN1, also known as chimerin 1, is a TPase-activating protein for ras-related p21-rac and a phorbol…
Name : Recombinant Human CHL-1/L1CAM-2 Protein (His Tag)Biological Activity : Background : Neural cell adhesion molecule L1-like protein, also known as close homolog of L1 (CHL1) is the prototypic member…
Name : Recombinant Human Chk1 Protein (GST Tag)Biological Activity : Background : CHK1 / CHEK1 contains 1 protein kinase domain and belongs to the protein kinase superfamily, CAMK Ser/Thr protein…
Name : Recombinant Human Chitotriosidase/CHIT1 Protein (His Tag)Biological Activity : Background : Chitotriosidase, also known as Chitinase-1 and CHIT1, is a member of the glycosyl hydrolase 18 family and Chitinase…
Name : Recombinant Human CHI3L2 Protein (His Tag)Biological Activity : Background : Chondrocyte protein 39 (YKL-39), also known as Chitinase 3-like 2 (CHI3L2), is a secretory protein of articular chondrocytes…
Name : Recombinant Human CHEK2 Protein (GST Tag)Biological Activity : Background : In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical…
Name : Recombinant Human CGREF1/CGR11 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : Q99674-1NCBI…
Name : Recombinant Canine FGF1 ProteinBiological Activity : Background : aFGF, also known as FGF1 and HBGF-1, is a member of the fibroblast growth factor family. The biological activity of…
Name : Recombinant Human CGB7 Protein (His Tag)Biological Activity : Background : CGB7 (chorionic gonadotropin, beta polypeptide 7) belongs to the glycoprotein hormones subunit beta family. Glycoprotein hormones are heterodimers…
Name : Recombinant Human CGB5 Protein (His Tag)Biological Activity : Background : The human CGB5 gene encodes chorionic gonadotropin (hCG)beta 5, which is aberrantly expressed in trophoblastic neoplasm and in…
Name : Recombinant Human CGB5 Protein (mFc Tag)Biological Activity : Background : The human CGB5 gene encodes chorionic gonadotropin (hCG)beta 5, which is aberrantly expressed in trophoblastic neoplasm and in…
Name : Recombinant Human Factor H-related 2/CFHR2 Protein (His Tag)Biological Activity : Background : CFHR2 belongs to the complement Factor H protein family. The human complement Factor H protein family…
Name : Recombinant Human Factor H-related 1/CFHR1 Protein (His Tag)Biological Activity : Background : CFHR1 is a secreted protein belonging to the complement Factor H protein family.The human complement Factor…
Name : Recombinant Human CES1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : CES1 encodes carboxylesterase-1, an important drug-metabolizing enzyme with high expression in the liver. Variants generated by the…
Name : Recombinant Human CER1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No. :…
Name : Recombinant Human CEP57 Protein (GST Tag)Biological Activity : Background : CEP57 is a centrosomal protein and is involved in nucleating and stabilizing microtubules. CEP57 was initially identified as…
Name : Recombinant Human Centrin 2 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human Centrin 2 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : E. coliTag : Protein Accession No. :…
Name : Recombinant Canine Ephrin B2 Protein (His Tag)Biological Activity : Background : EphrinB2 also known as EFNB2 is a member of the ephrin family. EphrinB2 is involved in establishing…
Name : SARS-CoV-2 (2019-nCoV) Spike S1+S2 ECD (HV69-70 deletion, D614G, D796H)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to…
Name : Recombinant Human CENPB Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No. : NP_001801.1NCBI…
Name : Recombinant Human CECR1 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No. : AAH51755.1NCBI…
Name : Recombinant Human CEBP gamma Protein (His Tag)Biological Activity : Background : CEBPG, also known as CEBP gamma, is a transcription factor which belongs to the CEBP family. Members…
Name : Recombinant Human CEACAM-6/CD66c Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6), also known as nonspecific crossreacting antigen (NCA)…
Name : Recombinant Human CEACAM-6/CD66c Protein (His Tag), HPLC-verified, Amine-Labeled BiotinylatedBiological Activity : Background : Carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6), also known as nonspecific crossreacting antigen (NCA) and…
Name : Recombinant Human CEACAM-6/CD66c Protein (His Tag), HPLC-verifiedBiological Activity : Background : Carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6), also known as nonspecific crossreacting antigen (NCA) and CD66c, is…
Name : Recombinant Human CEACAM-6/CD66c Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : Carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6), also known as nonspecific crossreacting antigen (NCA) and CD66c, is…
Name : Recombinant Human CEACAM-5/CD66e Protein (hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : CEACAM5, also known as CEA or CD66e, belongs to the large CEACAM subfamily of…
Name : Recombinant Human CEACAM-5/CD66e Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : CEACAM5, also known as CEA or CD66e, belongs to the large CEACAM subfamily of…
Name : Recombinant Human CEACAM-5/CD66e Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : CEACAM5, also known as CEA or CD66e, belongs to the large CEACAM subfamily of the immunoglobulin…
Name : Recombinant Canine Ephrin B2 Protein (hFc Tag)Biological Activity : Background : EphrinB2 also known as EFNB2 is a member of the ephrin family. EphrinB2 is involved in establishing…
Name : Recombinant Human CEACAM-5/CD66e Protein (His Tag), HPLC-verifiedBiological Activity : Background : CEACAM5, also known as CEA or CD66e, belongs to the large CEACAM subfamily of the immunoglobulin superfamily.…
Name : Recombinant Human CEACAM-5/CD66e Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : CEACAM5, also known as CEA or CD66e, belongs to the large CEACAM subfamily of the immunoglobulin superfamily.…
Name : Recombinant Human CEACAM-3/CD66d Protein (His Tag), HPLC-verifiedBiological Activity : Background : CeACAM3 (CD66d), a member of carcinoembryonic antigen family, is a granulocyte-specific receptor involved in the opsonin-independent recognition…
Name : Recombinant Human CEACAM19 Protein (ECD, His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human CEACAM-1/CD66a Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : The carcinoembryonic-antigen-related cell-adhesion molecule (CEACAM) family of proteins has been implicated in various intercellular-adhesion and intracellular-signalling-mediated…
Name : Recombinant Human CEACAM-1/CD66a Protein (ECD, His & hFc Tag)Biological Activity : Background : The carcinoembryonic-antigen-related cell-adhesion molecule (CEACAM) family of proteins has been implicated in various intercellular-adhesion and…
Name : Recombinant Human CDO Protein (His Tag)Biological Activity : Background : Cell adhesion molecule-related, down-regulated by oncogenes (CDON), also known as CDO, is an Ig superfamily member, is a…
Name : Recombinant Human CDNF Protein (His Tag)Biological Activity : Background : Cerebral Dopamine Neurotrophic Factor (CDNF), also known as ARMETL1 (ARMET-like protein 1), is a secreted protein with eight…
Name : Recombinant Human CDNF Protein (hFc Tag)Biological Activity : Background : Cerebral Dopamine Neurotrophic Factor (CDNF), also known as ARMETL1 (ARMET-like protein 1), is a secreted protein with eight…
Name : Recombinant Human CDKL2 Protein (His Tag)Biological Activity : Background : Cyclin-dependent kinase-like 2 (Cdkl2) is a member of cdc2-related serine / threonine protein kinase family and it is…
Name : Recombinant Canine Ephrin A5 Protein (hFc Tag)Biological Activity : Background : Ephrin-A5 also known as EFNA5, is a member of the Ephrin family. The Eph family receptor interacting…
Name : Recombinant Human CDK7 & CCNH & MNAT1 Protein (His Tag)Biological Activity : Background : Biological Activity : The specific activity is >5 nmol/min/mg using MBP as substrate.Expression Host…
Name : Recombinant Human CDK5 Protein (GST Tag)Biological Activity : Background : Cell division protein kinase 5, also known as Cyclin-dependent kinase 5, Serine/threonine-protein kinase PSSALRE, Tau protein kinase II…
Name : Recombinant Human CDK4 Protein (GST Tag)Biological Activity : Background : CDK4 is a member of the Ser/Thr protein kinase family. It is highly similar to the gene products…
Name : Recombinant Human CDK2AP2 Protein (His Tag)Biological Activity : Background : CDK2AP2 belongs to the CDK2AP family. Members of this family of proteins are cell-growth suppressors, associating with and…
Name : Recombinant Human CDK2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : CDK2 is a member of the Ser/Thr protein kinase family. This protein kinase is highly similar to…
Name : Recombinant Human CDK1 & CCNE1 Heterodimer Protein (His & GST Tag)Biological Activity : Background : Biological Activity : No Kinase ActivityExpression Host : HumanSource : Baculovirus-Insect CellsTag :…
Name : Recombinant Human CDK1/CDC2 Protein (GST Tag)Biological Activity : Background : CDC2, also known as CDK1, contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC…
Name : Recombinant Human CDH12 Protein (His Tag)Biological Activity : Background : Classic Cadherins represent a family of calcium-dependent homophilic cell-cell adhesion molecules. They confer strong adhesiveness to animal cells…
Name : Recombinant Human CDCP1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : CDCP1 contains three extracellular CUB domains. It is a putative stem cell marker that is highly expressed…
Name : Recombinant Human CDCP1 Protein (mFc Tag), HPLC-verifiedBiological Activity : Background : CDCP1 contains three extracellular CUB domains. It is a putative stem cell marker that is highly expressed…
Name : Recombinant Canine EGFR Protein (His Tag), HPLC-verifiedBiological Activity : Background : As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I transmembrane…
Name : Recombinant Human CDC42BPB Protein (His & GST Tag)Biological Activity : Background : CDC42BPB is a member of the serine / threonine protein kinase family that contains a Cdc42…
Name : Recombinant Human CDC42 Protein (GST Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : E. coliTag : Protein Accession No. : P60953-2NCBI…
Name : Recombinant Human CDC37 Protein (GST Tag)Biological Activity : Background : CDC37 is a protein that is expressed in proliferative zones during embryonic development and in adult tissues, consistent…
Name : Recombinant Human CD99 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds…
Name : Recombinant Human CD99 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds…
Name : Recombinant Human CD98 Protein (ECD, His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : 4F2 cell-surface antigen heavy chain, also known as 4F2 heavy chain antigen, Lymphocyte activation antigen…
Name : Recombinant Human CD98 Protein (His Tag), HPLC-verifiedBiological Activity : Background : 4F2 cell-surface antigen heavy chain, also known as 4F2 heavy chain antigen, Lymphocyte activation antigen 4F2 large…
Name : Recombinant Human CD97 Protein (His Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in immunophenotyping. Different kinds of cells…
Name : Recombinant Human CD97 Protein (hFc Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in immunophenotyping. Different kinds of cells…
Name : Recombinant Human CD96 Protein (hFc & AVI Tag), BiotinylatedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different…
Name : Recombinant Canine EGF ProteinBiological Activity : Background : EGF is the founding member of the EGF-family of proteins. Members of this protein family have highly similar structural and…
Name : Recombinant Human CD96 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds…
Name : Recombinant Human CD96 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD94/KLRD1 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : Q13241-1NCBI…
Name : Recombinant Human CD94/KLRD1 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : Q13241-1NCBI…
Name : Recombinant Human C1qR1/CD93 Protein (His Tag), HPLC-verifiedBiological Activity : Background : CD93 or C1q receptor 1 (C1qR) is an about 120 kDa O-sialoglycoprotein that within the hematopoietic system…
Name : Recombinant Human C1qR1/CD93 Protein (hFc Tag)Biological Activity : Background : CD93 or C1q receptor 1 (C1qR) is an about 120 kDa O-sialoglycoprotein that within the hematopoietic system is…
Name : Human CD9-VLP (Full Length) Protein (Flag Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD9 Protein (His Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of cells…
Name : Recombinant Human CD8A & CD8B Heterodimer Protein (Flag & His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293…
Name : Recombinant Human CD8A & CD8B Heterodimer Protein (Flag & His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag :…
Name : Recombinant Canine EGF Protein (His Tag)Biological Activity : Background : EGF is the founding member of the EGF-family of proteins. Members of this protein family have highly similar…
Name : Recombinant Human CD89/FCAR Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : FCAR, also called FcαRI or CD89, is a type I transmembrane receptor for…
Name : Recombinant Human CD89/FCAR Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : FCAR, also called FcαRI or CD89, is a type I transmembrane receptor for Fc region of…
Name : Recombinant Human B7-2/CD86 Protein (His & AVI Tag), BiotinylatedBiological Activity : Background : CD86, also known as B-lymphocyte activation antigen B7-2 (referred to as B70), is a member…
Name : Recombinant Human B7-2/CD86 Protein (hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : CD86, also known as B-lymphocyte activation antigen B7-2 (referred to as B70), is a…
Name : Recombinant Human B7-2/CD86 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : CD86, also known as B-lymphocyte activation antigen B7-2 (referred to as B70), is a member of…
Name : Recombinant Human B7-2/CD86 Protein (His Tag)Biological Activity : Background : CD86, also known as B-lymphocyte activation antigen B7-2 (referred to as B70), is a member of the cell…
Name : Recombinant Human B7-2/CD86 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : CD86, also known as B-lymphocyte activation antigen B7-2 (referred to as B70), is a member of…
Name : Recombinant Human CD84 Protein (His Tag)Biological Activity : Background : The CD2 family receptors are type I transmembrane glycoproteins belonging to immunoglobulin (Ig) superfamily characterized by a membrane-proximal…
Name : Recombinant Human CD83 Protein (His Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of cells…
Name : Recombinant Human CD82 Protein (His Tag)Biological Activity : Background : CD82, also known as KAI-1, structurally belongs to tetraspanin family while categorised as metastasis suppressor gene on functional…
Name : Recombinant Canine CXCL16 Protein (His Tag)Biological Activity : Background : C-X-C motif chemokine 16, also known as Small-inducible cytokine B16, SR-PSOX, and CXCL16, is a single-pass type I…
Name : Recombinant Human CD81 Protein, HPLC-verifiedBiological Activity : Background : CD81, also known as TAPA-1, belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Members of…
Name : Recombinant Human CD81 Protein (ECD, His Tag)Biological Activity : Background : CD81, also known as TAPA-1, belongs to the transmembrane 4 superfamily, also known as the tetraspanin family.…
Name : Recombinant Human CD81 Protein (mFc Tag)Biological Activity : Background : CD81, also known as TAPA-1, belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Members…
Name : Recombinant Human CD8 beta Protein, Amine-Labeled BiotinylatedBiological Activity : Background : CD8b (CD8b molecule), also known as P37 and LEU2, contains 1 Ig-like V-type (immunoglobulin-like) domain. The CD8…
Name : Recombinant Human CD8 beta ProteinBiological Activity : Background : CD8b (CD8b molecule), also known as P37 and LEU2, contains 1 Ig-like V-type (immunoglobulin-like) domain. The CD8 antigen is…
Name : Recombinant Human CD8 beta Protein (hFc Tag)Biological Activity : Background : CD8b (CD8b molecule), also known as P37 and LEU2, contains 1 Ig-like V-type (immunoglobulin-like) domain. The CD8…
Name : Recombinant Human CD8 alpha Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : T-cell surface glycoprotein CD8 alpha chain, also known as CD8a, is a…
Name : Recombinant Human CD8 alpha Protein (ECD, His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : T-cell surface glycoprotein CD8 alpha chain, also known as CD8a, is a single-pass type…
Name : Recombinant Human CD8 alpha Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : T-cell surface glycoprotein CD8 alpha chain, also known as CD8a, is a single-pass type I…
Name : Recombinant Human CD8 alpha Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : T-cell surface glycoprotein CD8 alpha chain, also known as CD8a, is a single-pass type I…
Name : Recombinant Canine CXCL16 Protein (hFc Tag)Biological Activity : Background : C-X-C motif chemokine 16, also known as Small-inducible cytokine B16, SR-PSOX, and CXCL16, is a single-pass type I…
Name : Recombinant Human CD79B Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant Human CD79A Protein (rFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_001774.1NCBI…
Name : Recombinant Human CD79A Protein (ECD, His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human CD79 Protein (Flag & His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession…
Name : Recombinant Mouse CD74 Protein (ECD, His Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD74 Protein (ECD, His Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human 5'-nucleotidase/CD73/NT5E Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : 5'-nucleotidase, also known as NT5E, NTE, and CD73, is a cell membrane protein that…
Name : Recombinant Human 5'-nucleotidase/CD73/NT5E Protein (His Tag), HPLC-verifiedBiological Activity : Background : 5'-nucleotidase, also known as NT5E, NTE, and CD73, is a cell membrane protein that belongs to the…
Name : Recombinant Human 5'-nucleotidase/CD73/NT5E Protein (hFc Tag)Biological Activity : Background : 5'-nucleotidase, also known as NT5E, NTE, and CD73, is a cell membrane protein that belongs to the 5'-nucleotidase…
Name : Recombinant Human CD72 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant Canine CTLA-4 Protein (ECD, His Tag)Biological Activity : Background : Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane protein…
Name : Recombinant Human CD72 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant Human CD70/CD27 Ligand Protein (ECD, hFc & AVI Tag), BiotinylatedBiological Activity : Background : CD70, a member of the tumor necrosis factor superfamily, is restricted to activated…
Name : Recombinant Human CD70/CD27 Ligand Protein (rFc Tag)Biological Activity : Background : CD70, a member of the tumor necrosis factor superfamily, is restricted to activated T-and B-lymphocytes and mature…
Name : Recombinant Human CD70/CD27 Ligand Protein (Trimer, His Tag), HPLC-verifiedBiological Activity : Background : CD70, a member of the tumor necrosis factor superfamily, is restricted to activated T-and B-lymphocytes…
Name : Recombinant Human CD70/CD27 Ligand Protein (mFc Tag)Biological Activity : Background : CD70, a member of the tumor necrosis factor superfamily, is restricted to activated T-and B-lymphocytes and mature…
Name : Recombinant Human CD70/CD27 Ligand Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : CD70, a member of the tumor necrosis factor superfamily, is restricted to activated T-and B-lymphocytes and…
Name : Recombinant Human CD70/CD27 Ligand Protein (hFc Tag)Biological Activity : Background : CD70, a member of the tumor necrosis factor superfamily, is restricted to activated T-and B-lymphocytes and mature…
Name : Recombinant Human CD7 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in…
Name : Recombinant Human CD7 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD7 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds…
Name : Recombinant Canine CTLA-4 Protein (ECD, hFc Tag)Biological Activity : Background : Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane protein…
Name : Recombinant Human CD69 Protein (His Tag)Biological Activity : Background : Early activation antigen CD69, also known as activation inducer molecule (AIM), is a single-pass type II membrane protein.…
Name : Recombinant Human CD68 Protein (aa 1-319, His Tag), HPLC-verifiedBiological Activity : Background : Macrosialin, also known as CD68 and Gp11, is a single-pass type I membrane protein which…
Name : Recombinant Human CD68 Protein (ECD, hFc Tag)Biological Activity : Background : Macrosialin, also known as CD68 and Gp11, is a single-pass type I membrane protein which belongs to…
Name : Recombinant Human CEACAM-8/CD66b Protein (His & AVI Tag), BiotinylatedBiological Activity : Background : CEACAM8, also known as CD66b or NCA-95, is a single chain, GPI-anchored, highly glycosylated protein…
Name : Recombinant Human CEACAM-8/CD66b Protein (His Tag), HPLC-verifiedBiological Activity : Background : CEACAM8, also known as CD66b or NCA-95, is a single chain, GPI-anchored, highly glycosylated protein belonging to…
Name : Recombinant Human CD64/FCGR1 Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : High affinity immunoglobulin gamma Fc receptor I, also known as FCGR1 and CD64, is…
Name : Recombinant Human CD64/FCGR1 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : High affinity immunoglobulin gamma Fc receptor I, also known as FCGR1 and CD64, is an integral…
Name : Recombinant Human CD64/FCGR1 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : High affinity immunoglobulin gamma Fc receptor I, also known as FCGR1 and CD64, is an integral…
Name : Recombinant Human CD63 Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping.…
Name : Recombinant Human CD63 Protein (ECD, His Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Canine CD40 Ligand/TNFSF5 ProteinBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in immunophenotyping. Different kinds of cells in…
Name : SARS-CoV-2 (2019-nCoV) Spike S1+S2 ECD (D614G)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on…
Name : Recombinant Human CD63 Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD6 Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : T-cell differentiation antigen CD6, also known as TP12 and CD6, is a single-pass type…
Name : Recombinant Human CD6 Protein (hFc Tag)Biological Activity : Background : T-cell differentiation antigen CD6, also known as TP12 and CD6, is a single-pass type I membrane protein which…
Name : Recombinant Human CD5L Protein (His Tag)Biological Activity : Background : CD5L, also known as CD5 antigen-like, is a soluble protein belonging to group B of the scavenger receptor…
Name : Recombinant Human CD59 Protein (His Tag), HPLC-verifiedBiological Activity : Background : CD59 glycoprotein, also known as 2 kDa homologous restriction factor, HRF2, MAC-inhibitory protein, Membrane attack complex inhibition…
Name : Recombinant Human CD58/LFA-3 Protein (His Tag)Biological Activity : Background : CD53 is a member of the transmembrane 4 superfamily, also called the tetraspanin family. Most of these members…
Name : Recombinant Human CD58/LFA-3 Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : CD53 is a member of the transmembrane 4 superfamily, also called the tetraspanin family. Most of these…
Name : Recombinant Human CD57/B3gat1 Protein (mFc Tag)Biological Activity : Background : B3GAT1 is the key enzyme during the biosynthesis of the carbohydrate epitope HNK-1, which is present on a number…
Name : Recombinant Human CD55/DAF Protein (His Tag), HPLC-verifiedBiological Activity : Background : CD55, also well known as decay-accelerating factor (DAF), is a member of the RCA (regulators of complement…
Name : Recombinant Human CD55/DAF Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : CD55, also well known as decay-accelerating factor (DAF), is a member of the RCA (regulators of complement…
Name : Recombinant Canine CD40 Ligand/TNFSF5 Protein (mFc Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in immunophenotyping. Different kinds of…
Name : Recombinant Human CD52 Protein (hFc & AVI Tag), BiotinylatedBiological Activity : Background : CD52 / CDW52 is a small glycosylphosphatidylinositol (GPI) anchored glycoprotein. It has a mature peptide…
Name : Recombinant Human CD52 Protein (hFc Tag)Biological Activity : Background : CD52 / CDW52 is a small glycosylphosphatidylinositol (GPI) anchored glycoprotein. It has a mature peptide comprising only 12…
Name : Recombinant Human ICAM-3/CD50 Protein (His Tag)Biological Activity : Background : The protein ICAM-3, also known as CD50, is a member of the intercellular adhesion molecule (ICAM) family consisting…
Name : Recombinant Human ICAM-3/CD50 Protein (His & hFc Tag)Biological Activity : Background : The protein ICAM-3, also known as CD50, is a member of the intercellular adhesion molecule (ICAM)…
Name : Recombinant Human CD5 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in…
Name : Recombinant Human CD5 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds…
Name : Recombinant Human CD5 Protein (ECD, hFc Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD48 Protein (His & AVI Tag), BiotinylatedBiological Activity : Background : Cluster of Differentiation 48 (CD48), also known as SLAMF2, BCM-1 and BLAST-1, is a GPI-linked…
Name : Recombinant Human CD48 Protein (hFc & AVI Tag), BiotinylatedBiological Activity : Background : Cluster of Differentiation 48 (CD48), also known as SLAMF2, BCM-1 and BLAST-1, is a GPI-linked…
Name : Recombinant Human CD48 Protein (His Tag)Biological Activity : Background : Cluster of Differentiation 48 (CD48), also known as SLAMF2, BCM-1 and BLAST-1, is a GPI-linked protein belonging to…
Name : Recombinant Canine CD40/TNFRSF5 ProteinBiological Activity : Background : CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily which are single transmembrane-spanning glycoproteins. CD40 protein…
Name : Recombinant Human CD48 Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : Cluster of Differentiation 48 (CD48), also known as SLAMF2, BCM-1 and BLAST-1, is a GPI-linked protein belonging…
Name : Recombinant Human CD47 Protein, Amine-Labeled BiotinylatedBiological Activity : Background : CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal cell binding domain of…
Name : Recombinant Human CD47 Protein (ECD), HPLC-verifiedBiological Activity : Background : CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal cell binding domain of…
Name : Recombinant Human CD47 Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal…
Name : Recombinant Human CD47 Protein (His Tag), HPLC-verifiedBiological Activity : Background : CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal cell binding domain…
Name : Recombinant Human CD47 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal cell binding…
Name : Recombinant Human CD47 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal cell binding…
Name : Recombinant Human CD46 Protein (His Tag), HPLC-verifiedBiological Activity : Background : CD46, also known as Membrane Cofactor Protein (MCP), is a complement regulatory protein. CD46 is a type…
Name : Recombinant Human CD45 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD45 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in…
Name : Recombinant Canine CD40/TNFRSF5 Protein (His Tag)Biological Activity : Background : CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily which are single transmembrane-spanning glycoproteins.…
Name : Recombinant Human CD45 Protein (ECD, His Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD45 Protein (hFc Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of cells…
Name : Recombinant Human CD44 Protein (ECD), HPLC-verifiedBiological Activity : Background : CD44 is a type I transmembrane protein and a member of the cartilage link protein family. It is…
Name : Recombinant Human CD44 Protein (His Tag), HPLC-verifiedBiological Activity : Background : CD44 is a type I transmembrane protein and a member of the cartilage link protein family. It…
Name : Recombinant Human CD44 Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : CD44 is a type I transmembrane protein and a member of the cartilage link protein family. It…
Name : Recombinant Human CD42c Protein (His Tag)Biological Activity : Background : Platelet glycoprotein Ib (GPIb) complex is best known as a major platelet receptor for von Willebrand factor essential…
Name : Recombinant Human CD42b/GP1BA Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant Human CD42b/GP1BA Protein (His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human CD40 Ligand/TNFSF5 Protein (ECD, hFc & AVI Tag), BiotinylatedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in…
Name : Recombinant Human CD40 Ligand/TNFSF5 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in immunophenotyping. Different kinds…
Name : Recombinant Canine CD40/TNFRSF5 Protein (hFc Tag)Biological Activity : Background : CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily which are single transmembrane-spanning glycoproteins.…
Name : Recombinant Human CD40 Ligand/TNFSF5 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in immunophenotyping. Different…
Name : Recombinant Human CD40/TNFRSF5 Protein (ECD, hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily…
Name : Recombinant Human CD40/TNFRSF5 Protein (ECD, mFc Tag)Biological Activity : Background : CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily which are single transmembrane-spanning…
Name : Recombinant Human CD40/TNFRSF5 Protein (ECD, His & AVI Tag), HPLC-verified, BiotinylatedBiological Activity : Background : CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily…
Name : Recombinant Human CD40/TNFRSF5 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily which are single…
Name : Recombinant Human CD40/TNFRSF5 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily which are single…
Name : Recombinant Human CD4 Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : T-cell surface glycoprotein CD4, is a single-pass type I membrane protein. CD4 contains three…
Name : Recombinant Human CD4 Protein (aa 1-208, His Tag), HPLC-verifiedBiological Activity : Background : T-cell surface glycoprotein CD4, is a single-pass type I membrane protein. CD4 contains three Ig-like…
Name : Recombinant Human CD4 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : T-cell surface glycoprotein CD4, is a single-pass type I membrane protein. CD4 contains three Ig-like C2-type…
Name : Recombinant Human CD4 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : T-cell surface glycoprotein CD4, is a single-pass type I membrane protein. CD4 contains three Ig-like C2-type…
Name : Recombinant Canine CD3 delta/CD3d Protein (hFc Tag)Biological Activity : Background : T-cell surface glycoprotein CD3 delta chain, also known as CD3d, is a single-pass type I membrane protein.…
Name : Recombinant Human CD4 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : T-cell surface glycoprotein CD4, is a single-pass type I membrane protein. CD4 contains three Ig-like C2-type…
Name : Recombinant Human CD3e & CD3G Heterodimer Protein (Fc-Flag & Fc-His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Immobilized Anti-CD3 antibody, mouse IgG2a at 2 μg/mL (100…
Name : Recombinant Human CD3e & CD3G Heterodimer Protein (Fc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession…
Name : Recombinant Human CD3e & CD3G Heterodimer Protein (ECD, Fc-Flag & mFc Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293…
Name : Recombinant Human CD3d & CD3E Heterodimer Protein (Flag & His Tag), Amine-Labeled Biotinylated, HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource :…
Name : Recombinant Human CD3d & CD3E Heterodimer Protein (ECD, Flag & His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Measured by its binding ability in a functional…
Name : Recombinant Human CD3d & CD3E Heterodimer Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Immobilized Recombinant Human CD3d & CD3E Heterodimer Protein (ECD, His…
Name : Recombinant Human CD38 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in…
Name : Recombinant Human CD3d & CD3E Heterodimer Protein (ECD), HPLC-verifiedBiological Activity : Background : Biological Activity : Measured by its ability to bind OKT3-mIgG2a (Cat: 10977-M001) in a functional…
Name : Recombinant Human CD3 delta/CD3d Protein (hFc & FLAG Tag), Amine-Labeled BiotinylatedBiological Activity : Background : T-cell surface glycoprotein CD3 delta chain, also known as CD3d, is a single-pass…
Name : Recombinant Human CD3 delta/CD3d Protein (hFc & FLAG Tag)Biological Activity : Background : T-cell surface glycoprotein CD3 delta chain, also known as CD3d, is a single-pass type I…
Name : Recombinant Canine CD3 epsilon/CD3e Protein (hFc Tag)Biological Activity : Background : T-cell surface glycoprotein CD3 epsilon chain, also known as CD3e, is a single-pass type I membrane protein.…
Name : Recombinant Human CD3 delta/CD3d Protein (His Tag)Biological Activity : Background : T-cell surface glycoprotein CD3 delta chain, also known as CD3d, is a single-pass type I membrane protein.…
Name : Recombinant Human CD39/ENTPD1 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : CD39, also known as ENTPD1, belongs to the GDA1/CD39 NTPase family. It is expressed primarily on…
Name : Human CD38-VLP (Full Length) ProteinBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of cells in…
Name : Recombinant Human CD38 Protein (hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping.…
Name : Recombinant Human CD38 Protein (His & FLAG Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds…
Name : Recombinant Human CD38 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds…
Name : Recombinant Human CD38 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds…
Name : Recombinant Human CD37 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant Human CD36 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in…
Name : Recombinant Canine CD2 Protein (His Tag)Biological Activity : Background : T-cell surface antigen CD2, also known as T-cell surface antigen T11/Leu-5, and SRBC, is a single-pass type I…
Name : Recombinant Human CD36 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds…
Name : Recombinant Human CD34 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Cluster of Differentiation 34 (CD34) is a member of a family of single-pass…
Name : Recombinant Human CD34 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Cluster of Differentiation 34 (CD34) is a member of a family of single-pass transmembrane sialomucin proteins, and…
Name : Recombinant Human CD34 Protein (hFc Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Cluster of Differentiation 34 (CD34) is a member of a family of single-pass transmembrane sialomucin proteins,…
Name : Recombinant Human CD34 Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : Cluster of Differentiation 34 (CD34) is a member of a family of single-pass transmembrane sialomucin proteins, and…
Name : Recombinant Human Siglec-3/CD33 Protein, HPLC-verifiedBiological Activity : Background : Myeloid cell surface antigen CD33 also known as Sialic acid binding Ig-like lectin 3, CD33 antigen or Siglec-3, is…
Name : Recombinant Human Siglec-3/CD33 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Myeloid cell surface antigen CD33 also known as Sialic acid binding Ig-like lectin 3, CD33 antigen…
Name : Recombinant Human Siglec-3/CD33 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Myeloid cell surface antigen CD33 also known as Sialic acid binding Ig-like lectin 3, CD33 antigen…
Name : Recombinant Human Siglec-3/CD33 Protein (mFc Tag)Biological Activity : Background : Myeloid cell surface antigen CD33 also known as Sialic acid binding Ig-like lectin 3, CD33 antigen or Siglec-3,…
Name : Recombinant Human Siglec-3/CD33 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : Myeloid cell surface antigen CD33 also known as Sialic acid binding Ig-like lectin 3, CD33 antigen…
Name : Recombinant Canine CD2 Protein (hFc Tag)Biological Activity : Background : T-cell surface antigen CD2, also known as T-cell surface antigen T11/Leu-5, and SRBC, is a single-pass type I…
Name : Recombinant Human CD32B/Fcgr2b Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Biological Activity : Loaded Biotinylated Human FcγRIIB/C / CD32b/c protein (His & Avi Tag)…
Name : Recombinant Human CD32B/Fcgr2b Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Measured by its ability to bind biotinylated human IgG2 (Cat: 13504-HNAH) in functional…
Name : Recombinant Human CD32B/Fcgr2b Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : 1.Immobilized Human FcγRIIB/C / CD32b/c recombinant protein (Cat. 10259-H08C) can bind biotinylated human…
Name : Recombinant Human CD32A/FCGR2A Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Biological Activity : Loaded Biotinylated Recombinant Human FcγRIIA / CD32a protein (H131), His &…
Name : Recombinant Human CD32A/FCGR2A Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Biological Activity : 1.Loaded Biotinylated Human FcγRIIA / CD32a (H167) recombinant protein (His &…
Name : Recombinant Human CD32A/FCGR2A Protein (167 Arg, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Biological Activity : 1. Loaded Biotinylated Human FcγRIIA / CD32a (R167) recombinant…
Name : Recombinant Human CD32A/FCGR2A Protein (167 His, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : 1.Loaded Rituximab (IgG1) on ProA Biosensor, can bind Human FcγRIIA / CD32a…
Name : Recombinant Human CD32A/FCGR2A Protein (167 Arg, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : 1.Loaded Rituximab (IgG1) on ProA Biosensor, can bind Human FcγRIIA / CD32a…
Name : Recombinant Human CD32A/FCGR2A Protein (167 His, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : 1.Measured by its binding ability in a functional ELISA.2.Immobilized human CD32a-His (R167H)…
Name : Recombinant Human CD32A/FCGR2A Protein (167 Arg, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : 1.Measured by its ability to bind Human IgG1(Cat:10702-HNAH-B), Biotinylated in a functional ELISA.2.Loaded…
Name : Recombinant Canine 4-1BB/CD137 Protein (His Tag), HPLC-verifiedBiological Activity : Background : CD137 (also known as 4-1BB) is a surface co-stimulatory glycoprotein originally described as present on activated T…
Name : Recombinant Human CD32A/FCGR2A Protein (167 Arg, hFc Tag)Biological Activity : Background : Biological Activity : Measured by its binding ability in a functional ELISA.Immobilized human CD32a-Fc (Cat:10374-H02H) at…
Name : Recombinant Human CD31/PECAM-1 ProteinBiological Activity : Background : The Cluster of Differentiation 31 (CD31) adhesion molecule, also known as platelet-endothelial cell adhesion molecule-1 (PECAM-1), is the only known…
Name : Recombinant Human CD31/PECAM-1 Protein (His Tag)Biological Activity : Background : The Cluster of Differentiation 31 (CD31) adhesion molecule, also known as platelet-endothelial cell adhesion molecule-1 (PECAM-1), is the…
Name : Recombinant Human CD31/PECAM-1 Protein (hFc Tag)Biological Activity : Background : The Cluster of Differentiation 31 (CD31) adhesion molecule, also known as platelet-endothelial cell adhesion molecule-1 (PECAM-1), is the…
Name : Recombinant Human CD30 Ligand/TNFSF8 ProteinBiological Activity : Background : CD30 ligand (CD30L), also known as CD153 and TNFSF8, is a membrane-associated glycoprotein belonging to the TNF superfamily and…
Name : Recombinant Human CD30 Ligand/TNFSF8 Protein (hFc Tag)Biological Activity : Background : CD30 ligand (CD30L), also known as CD153 and TNFSF8, is a membrane-associated glycoprotein belonging to the TNF…
Name : Recombinant Human CD300LB Protein (ECD, hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human CD300f/LMIR3 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human CD300f/LMIR3 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_620587.2NCBI…
Name : Recombinant Human CD300E Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : AAI00889.1NCBI…
Name : Recombinant Canine 4-1BB/CD137 Protein (hFc Tag)Biological Activity : Background : CD137 (also known as 4-1BB) is a surface co-stimulatory glycoprotein originally described as present on activated T lymphocytes,…
Name : SARS-CoV-2 (2019-nCoV) Spike S1+S2 ECD (R683A, R685A, K986P, V987P)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to…
Name : SARS-CoV-2 (2019-nCoV) NSP9-his & AVI Recombinant ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : SARS-CoV-2Source : E. coliTag : Protein Accession No. :…
Name : Recombinant Human CD300C/LMIR2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD300A/LMIR1 Protein (His Tag)Biological Activity : Background : CMRF35-like molecule 8, also known as CD300 antigen-like family member A, CMRF35-H9, Immunoglobulin superfamily member 12, Inhibitory receptor…
Name : Recombinant Human CD300A/LMIR1 Protein (hFc Tag)Biological Activity : Background : CMRF35-like molecule 8, also known as CD300 antigen-like family member A, CMRF35-H9, Immunoglobulin superfamily member 12, Inhibitory receptor…
Name : Recombinant Human CD30/TNFRSF8 Protein (His & AVI Tag), BiotinylatedBiological Activity : Background : CD30, also known as TNFRSF8, is a cell membrane protein of the tumor necrosis factor…
Name : Recombinant Human CD30/TNFRSF8 Protein (hFc & AVI Tag), BiotinylatedBiological Activity : Background : CD30, also known as TNFRSF8, is a cell membrane protein of the tumor necrosis factor…
Name : Recombinant Human CD30/TNFRSF8 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : CD30, also known as TNFRSF8, is a cell membrane protein of the tumor necrosis factor receptor…
Name : Recombinant Human CD30/TNFRSF8 Protein (His Tag)Biological Activity : Background : CD30, also known as TNFRSF8, is a cell membrane protein of the tumor necrosis factor receptor (TNFR) superfamily.…
Name : Recombinant Human CD30/TNFRSF8 Protein (ECD, hFc Tag)Biological Activity : Background : CD30, also known as TNFRSF8, is a cell membrane protein of the tumor necrosis factor receptor (TNFR)…
Name : Recombinant Human CD3 zeta/CD247 ProteinBiological Activity : Background : CD247, also known as CD3-ZETA, belongs to the CD3Z/FCER1G family. It contains 3 ITAM domains. As a -cell receptor…
Name : Recombinant Human CD3 zeta/CD247 Protein (GST Tag)Biological Activity : Background : CD247, also known as CD3-ZETA, belongs to the CD3Z/FCER1G family. It contains 3 ITAM domains. As a…
Name : Recombinant Canine IL-2R beta/CD122 Protein (His Tag)Biological Activity : Background : Interleukin-2 receptor (IL-2R) also known as High-affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and IL-2RB,…
Name : Recombinant Human CD3 epsilon/CD3e Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : T-cell surface glycoprotein CD3 epsilon chain, also known as CD3e, is a single-pass type I…
Name : Recombinant Human CD3 epsilon/CD3e Protein (His Tag)Biological Activity : Background : T-cell surface glycoprotein CD3 epsilon chain, also known as CD3e, is a single-pass type I membrane protein.…
Name : Recombinant Human CD3 epsilon/CD3e Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : T-cell surface glycoprotein CD3 epsilon chain, also known as CD3e, is a single-pass type I…
Name : Recombinant Human CD3 epsilon/CD3e Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : T-cell surface glycoprotein CD3 epsilon chain, also known as CD3e, is a single-pass type I…
Name : Recombinant Human DC-SIGNR/CD299 Protein (ECD)Biological Activity : Background : C-type lectin domain family 4, member M, also known as DC-SIGNR and CLEC4M, is a type II integral membrane…
Name : Recombinant Human DC-SIGNR/CD299 Protein (hFc Tag)Biological Activity : Background : C-type lectin domain family 4, member M, also known as DC-SIGNR and CLEC4M, is a type II integral…
Name : Recombinant Human CD28 Protein (ECD, hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : CD28 (Cluster of Differentiation 28) is a disulphide-bonded glycoprotein belonging to the immunoglobulin…
Name : Recombinant Human CD28 Protein (ECD, hFc Tag)Biological Activity : Background : CD28 (Cluster of Differentiation 28) is a disulphide-bonded glycoprotein belonging to the immunoglobulin (Ig) superfamily, and structurally…
Name : Recombinant Human CD27/TNFRSF7 Protein (hFc & AVI Tag), BiotinylatedBiological Activity : Background : CD27, also known as TNFRSF7, is a member of the TNF-receptor superfamily limited to cells…
Name : Recombinant Human CD27/TNFRSF7 Protein (rFc Tag), HPLC-verifiedBiological Activity : Background : CD27, also known as TNFRSF7, is a member of the TNF-receptor superfamily limited to cells of the…
Name : Recombinant Canine IL-2R beta/CD122 Protein (hFc Tag)Biological Activity : Background : Interleukin-2 receptor (IL-2R) also known as High-affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and IL-2RB,…
Name : Recombinant Human CD27/TNFRSF7 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : CD27, also known as TNFRSF7, is a member of the TNF-receptor superfamily limited to cells of…
Name : Recombinant Human CD27/TNFRSF7 Protein (His Tag)Biological Activity : Background : CD27, also known as TNFRSF7, is a member of the TNF-receptor superfamily limited to cells of the lymphoid…
Name : Recombinant Human CD27/TNFRSF7 Protein (ECD, hFc Tag)Biological Activity : Background : CD27, also known as TNFRSF7, is a member of the TNF-receptor superfamily limited to cells of the…
Name : Recombinant Human DPP-4/CD26/DPPIV Protein, HPLC-verifiedBiological Activity : Background : Dipeptidyl peptidase-4 (DPP4) or adenosine deaminase complexing protein 2 (ADCP 2) or T-cell activation antigen CD26 is a serine…
Name : Recombinant Human DPP-4/CD26/DPPIV Protein (His Tag)Biological Activity : Background : Dipeptidyl peptidase-4 (DPP4) or adenosine deaminase complexing protein 2 (ADCP 2) or T-cell activation antigen CD26 is a…
Name : Recombinant Human DPP-4/CD26/DPPIV Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : Dipeptidyl peptidase-4 (DPP4) or adenosine deaminase complexing protein 2 (ADCP 2) or T-cell activation antigen CD26 is…
Name : Recombinant Human CD25/IL-2R alpha Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : CD25 (alpha-chain of the IL-2 receptor, or IL2RA), is a type I…
Name : Recombinant Human CD25/IL-2R alpha Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : CD25 (alpha-chain of the IL-2 receptor, or IL2RA), is a type I transmembrane glycoprotein with…
Name : Recombinant Human CD25/IL-2R alpha Protein (ECD, hFc Tag)Biological Activity : Background : CD25 (alpha-chain of the IL-2 receptor, or IL2RA), is a type I transmembrane glycoprotein with a…
Name : Recombinant Human CD24 Protein (hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping.…
Name : Recombinant Canine Carbonic Anhydrase IX/CA9 Protein (His Tag)Biological Activity : Background : Carbonic Anhydrases IX (CA IX), also known as membrane antigen MN or CA9, is a member…
Name : Recombinant Human CD24 Protein (rFc Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of cells…
Name : Recombinant Human CD24 Protein (mFc Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD24 Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD23 Protein (His Tag)Biological Activity : Background : Fc fragment of IgE, low affinity II, receptor for (CD23) or CD23 antigen is a member of the…
Name : Recombinant Human DNAM-1/CD226 Protein (ECD, His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different…
Name : Recombinant Human DNAM-1/CD226 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds…
Name : Recombinant Human DNAM-1/CD226 Protein (ECD, hFc Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human Siglec-2/CD22 Protein (ECD)Biological Activity : Background : CD22 is a member of the immunoglobulin superfamily, SIGLEC family of lectins. It is first expressed in the cytoplasm…
Name : Recombinant Human Siglec-2/CD22 Protein (ECD, hFc & AVI Tag), BiotinylatedBiological Activity : Background : CD22 is a member of the immunoglobulin superfamily, SIGLEC family of lectins. It is…
Name : Recombinant Human Siglec-2/CD22 Protein (aa 176-687, His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : CD22 is a member of the immunoglobulin superfamily, SIGLEC family of lectins. It is…
Name : Recombinant Canine Carbonic Anhydrase IX/CA9 Protein (hFc Tag)Biological Activity : Background : Carbonic Anhydrases IX (CA IX), also known as membrane antigen MN or CA9, is a member…
Name : Recombinant Human Siglec-2/CD22 Protein (aa 176-687, His Tag)Biological Activity : Background : CD22 is a member of the immunoglobulin superfamily, SIGLEC family of lectins. It is first expressed…
Name : Recombinant Human Siglec-2/CD22 Protein (ECD, His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : CD22 is a member of the immunoglobulin superfamily, SIGLEC family of lectins. It is first…
Name : Recombinant Human Siglec-2/CD22 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : CD22 is a member of the immunoglobulin superfamily, SIGLEC family of lectins. It is first expressed…
Name : Recombinant Human Siglec-2/CD22 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : CD22 is a member of the immunoglobulin superfamily, SIGLEC family of lectins. It is first expressed…
Name : Recombinant Human CD21 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD204/MSR1 Protein (His Tag)Biological Activity : Background : Macrophage scavenger receptor types I and II, also known as Macrophage acetylated LDL receptor I and II, Scavenger…
Name : Recombinant Human CD200RLa Protein (His Tag)Biological Activity : Background : Cell surface glycoprotein CD2 receptor 2, also known as Cell surface glycoprotein CD2 receptor 1-like, Cell surface glycoprotein…
Name : Recombinant Human CD200R Protein (His Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD200R Protein (His & hFc Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds…
Name : Recombinant Human CD200 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : CD200 (OX-2) is a cell surface glycoprotein that imparts immune privileges by suppressing…
Name : Recombinant Canine Canf4 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : CanineSource : HEK293 CellsTag : Protein Accession No. : NP_001177855.1NCBI…
Name : Recombinant Human CD200 Protein (ECD, hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : CD200 (OX-2) is a cell surface glycoprotein that imparts immune privileges by suppressing…
Name : Recombinant Human CD200 Protein (His Tag), HPLC-verifiedBiological Activity : Background : CD200 (OX-2) is a cell surface glycoprotein that imparts immune privileges by suppressing alloimmune and autoimmune responses…
Name : Recombinant Human CD200 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : CD200 (OX-2) is a cell surface glycoprotein that imparts immune privileges by suppressing alloimmune and autoimmune…
Name : Human CD20 (Full Length) Protein-VLPBiological Activity : Background : CD20 (membrane-spanning 4-domains, subfamily A, member 1), also known as MS4A1, is a member of the membrane-spanning 4A gene…
Name : Recombinant Human CD20 Protein (TrxA Tag), Amine-Labeled BiotinylatedBiological Activity : Background : CD20 (membrane-spanning 4-domains, subfamily A, member 1), also known as MS4A1, is a member of the…
Name : Recombinant Human CD20 Protein (TrxA Tag)Biological Activity : Background : CD20 (membrane-spanning 4-domains, subfamily A, member 1), also known as MS4A1, is a member of the membrane-spanning 4A…
Name : Recombinant Human CD20 Protein (aa 213-297, His Tag), HPLC-verifiedBiological Activity : Background : CD20 (membrane-spanning 4-domains, subfamily A, member 1), also known as MS4A1, is a member of…
Name : Recombinant Human CD2 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : T-cell surface antigen CD2, also known as T-cell surface antigen T11/Leu-5, and SRBC, is a single-pass…
Name : Recombinant Human CD2 Protein (ECD, hFc Tag)Biological Activity : Background : T-cell surface antigen CD2, also known as T-cell surface antigen T11/Leu-5, and SRBC, is a single-pass type…
Name : Recombinant Human CD1D & B2M Heterodimer Protein (His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Immobilized anti-CD1D (1D12), Human IgG1 at 2 μg/mL (100 μL/well) can…
Name : Recombinant Canine CANF2 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : CanineSource : HEK293 CellsTag : Protein Accession No. : NP_001003189.1NCBI…
Name : Recombinant Human CD1B & B2M Heterodimer Protein (His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein…
Name : Recombinant Human CD1B Protein (hFc Tag)Biological Activity : Background : CD1B contains 1 Ig-like (immunoglobulin-like) domain and belongs to the CD1 family. CD1 family members are transmembrane glycoproteins,…
Name : Recombinant Human CD19 Protein (ECD, His & AVI Tag), BiotinylatedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping.…
Name : Recombinant Human CD19 Protein (hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping.…
Name : Recombinant Human CD19 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds…
Name : Recombinant Human CD19 Protein (ECD, His Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD19 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds…
Name : Recombinant Human CD19 Protein (ECD, hFc Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of…
Name : Recombinant Human CD177 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human CD177 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : AAH29167.1NCBI…
Name : Recombinant Canine Can f 1 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : CanineSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant Human CD16b/FCGR3B/Fc gamma RIIIB Protein (NA1 allotype, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Biological Activity : 1.Loaded Biotinylated Human FcγRIIIB / CD16b (NA1)…
Name : Recombinant Human CD16b/FCGR3B/Fc gamma RIIIB Protein (NA2 allotype, His & AVI Tag, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Biological Activity : 1.Loaded Biotinylated Human FcγRIIIB / CD16b (NA2) recombinant…
Name : Recombinant Human CD16b/FCGR3B/Fc gamma RIIIB Protein (NA2 allotype, His & AVI Tag, His & AVI Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag :…
Name : Recombinant Human CD16b/FCGR3B/Fc gamma RIIIB Protein (SH allotype, His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein…
Name : Recombinant Human CD16b/FCGR3B/Fc gamma RIIIB Protein (NA1 allotypes, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : 1.Loaded Human FcγRIIIB / CD16b (NA1) recombinant protein (Cat. 11046-H08H1)…
Name : Recombinant Human CD16b/FCGR3B/Fc gamma RIIIB Protein (NA2 allotype, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : 1.Loaded Human FcγRIIIB / CD16b (NA2) recombinant protein (Cat. 11046-H08H)…
Name : Recombinant Human CD16b/FCGR3B/Fc gamma RIIIB Protein (NA2 allotype, His Tag, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : CHO CellsTag : Protein…
Name : Recombinant Human CD16a/FCGR3A/Fc gamma RIIIA Protein (ECD, F176V, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The Fc receptor with low affinity for IgG (FCGR3, or…
Name : Recombinant Human CD16a/FCGR3A/Fc gamma RIIIA Protein (176 Val, His & AVI Tag)Biological Activity : Background : The Fc receptor with low affinity for IgG (FCGR3, or CD16) is…
Name : Recombinant Human CD16a/FCGR3A/Fc gamma RIIIA Protein (ECD, 176F, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The Fc receptor with low affinity for IgG (FCGR3, or…
Name : Recombinant Canine Can f 6 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : CanineSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant Human CD16a/FCGR3A/Fc gamma RIIIA Protein (ECD, 176 Phe, His & AVI Tag), HPLC-verifiedBiological Activity : Background : The Fc receptor with low affinity for IgG (FCGR3, or…
Name : Recombinant Human CD16a/FCGR3A/Fc gamma RIIIA Protein (ECD, F176V, His Tag), HPLC-verifiedBiological Activity : Background : The Fc receptor with low affinity for IgG (FCGR3, or CD16) is encoded…
Name : Recombinant Human CD16a/FCGR3A/Fc gamma RIIIA Protein (ECD, 176F, His Tag), HPLC-verifiedBiological Activity : Background : The Fc receptor with low affinity for IgG (FCGR3, or CD16) is encoded…
Name : Recombinant Human CD16a/FCGR3A/Fc gamma RIIIA Protein (ECD, F176V, His Tag), HPLC-verifiedBiological Activity : Background : The Fc receptor with low affinity for IgG (FCGR3, or CD16) is encoded…
Name : Recombinant Human CD16a/FCGR3A/Fc gamma RIIIA Protein (ECD, 176 Phe, His Tag), HPLC-verifiedBiological Activity : Background : The Fc receptor with low affinity for IgG (FCGR3, or CD16) is…
Name : Recombinant Human CD166/ALCAM Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Activated leukocyte cell adhesion molecule (ALCAM)/Cluster of differentiation (CD166) is a type I transmembrane cell adhesion…
Name : Recombinant Human CD166/ALCAM Protein (ECD, hFc Tag)Biological Activity : Background : Activated leukocyte cell adhesion molecule (ALCAM)/Cluster of differentiation (CD166) is a type I transmembrane cell adhesion molecule…
Name : Recombinant Human CD164 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Sialomucin core protein 24 also known as endolyn or CD164 (cluster of differentiation 164) is a novel…
Name : Recombinant Human CD160 Protein (His Tag)Biological Activity : Background : CD16 antigen, also known as Natural killer cell receptor BY55 and CD16, is a cell membrane protein which…
Name : Recombinant Human CD157 Protein (His Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in immunophenotyping. Different kinds of cells…
Name : Recombinant Canine c-MET/HGFR Protein (His Tag)Biological Activity : Background : Hepatocyte growth factor receptor (HGFR), also known as c-Met or mesenchymal-epithelial transition factor (MET), is a receptor tyrosine…
Name : Recombinant Human CD155/PVR ProteinBiological Activity : Background : CD155, commonly known as PVR (poliovirus receptor) and Necl-5 (nectin-like molecule-5), is a type I transmembrane single-span glycoprotein, and belongs…
Name : Recombinant Human CD155/PVR Protein (hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : CD155, commonly known as PVR (poliovirus receptor) and Necl-5 (nectin-like molecule-5), is a type…
Name : Recombinant Human CD155/PVR Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : CD155, commonly known as PVR (poliovirus receptor) and Necl-5 (nectin-like molecule-5), is a type…
Name : Recombinant Human CD155/PVR Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : CD155, commonly known as PVR (poliovirus receptor) and Necl-5 (nectin-like molecule-5), is a type I transmembrane…
Name : Recombinant Human CD155/PVR Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : CD155, commonly known as PVR (poliovirus receptor) and Necl-5 (nectin-like molecule-5), is a type I transmembrane…
Name : Recombinant Human CD147/Basigin/EMMPRIN Protein, HPLC-verifiedBiological Activity : Background : CD147/EMMPRIN (Extracellular Matrix Metalloproteinase Inducer), also known as Basigin (BSG), is a transmembrane glycoprotein with different forms resulted from…
Name : Recombinant Human CD147/Basigin/EMMPRIN Protein (His Tag), HPLC-verifiedBiological Activity : Background : CD147/EMMPRIN (Extracellular Matrix Metalloproteinase Inducer), also known as Basigin (BSG), is a transmembrane glycoprotein with different forms…
Name : Recombinant Human CD147/Basigin/EMMPRIN Protein (hFc Tag)Biological Activity : Background : CD147/EMMPRIN (Extracellular Matrix Metalloproteinase Inducer), also known as Basigin (BSG), is a transmembrane glycoprotein with different forms resulted…
Name : Recombinant Human CD146/MCAM Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : The CD146 antigen, also known as melanoma cell adhesion molecule (MCAM) and MUC18, is an integral…
Name : Recombinant Human CD146/MCAM Protein (His Tag)Biological Activity : Background : The CD146 antigen, also known as melanoma cell adhesion molecule (MCAM) and MUC18, is an integral membrane glycoprotein…
Name : Recombinant Canine BMPR1A/ALK-3 Protein (hFc Tag)Biological Activity : Background : Activin receptor-Like Kinase 3 (ALK-3), also known as Bone Morphogenetic Protein Receptor, type IA (BMPR1A), is a type…
Name : SARS-CoV-2 (2019-nCoV) Spike S1+S2 ECD-His Recombinant Protein, BiotinylatedBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on…
Name : Recombinant Human CD146/MCAM Protein (hFc Tag)Biological Activity : Background : The CD146 antigen, also known as melanoma cell adhesion molecule (MCAM) and MUC18, is an integral membrane glycoprotein…
Name : Recombinant Human CD14 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in immunophenotyping. Different kinds of…
Name : Recombinant Human CD14 Protein (hFc Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in immunophenotyping. Different kinds of cells…
Name : Recombinant Human 4-1BB/CD137 Protein (ECD, soluble CD137, His Tag)Biological Activity : Background : CD137 (also known as 4-1BB) is a surface co-stimulatory glycoprotein originally described as present on…
Name : Recombinant Human 4-1BB/CD137 Protein (ECD, hFc & AVI Tag), BiotinylatedBiological Activity : Background : CD137 (also known as 4-1BB) is a surface co-stimulatory glycoprotein originally described as present…
Name : Recombinant Human 4-1BB/CD137 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : CD137 (also known as 4-1BB) is a surface co-stimulatory glycoprotein originally described as…
Name : Recombinant Human 4-1BB/CD137 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : CD137 (also known as 4-1BB) is a surface co-stimulatory glycoprotein originally described as present on activated…
Name : Recombinant Human 4-1BB/CD137 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : CD137 (also known as 4-1BB) is a surface co-stimulatory glycoprotein originally described as present on activated…
Name : Recombinant Human 4-1BB/CD137 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : CD137 (also known as 4-1BB) is a surface co-stimulatory glycoprotein originally described as present on activated…
Name : Recombinant Human IL-3R Beta/IL3RB Protein (His Tag)Biological Activity : Background : Colony stimulating factor 2 receptor, beta, low-affinity (CSF2RB) also known as CD131 antigen (CD131), cytokine receptor common…
Name : Recombinant Canine BCA-1/CXCL13 Protein (His Tag)Biological Activity : Background : The chemokine CXCL13, also known as BCA-1 (B-cell-attracting chemokine-1) or BLC (B-lymphocyte chemoattractant), which belongs to the CXC…
Name : Recombinant Human CD13 Protein (I603M, His Tag), HPLC-verifiedBiological Activity : Background : Aminopeptidase N (ANPEP or APN), also known as CD13, is a cell-surface metalloprotease located in the…
Name : Recombinant Human IL-2R beta/CD122 Protein, HPLC-verifiedBiological Activity : Background : Interleukin-2 receptor (IL-2R) also known as High-affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and IL-2RB, is…
Name : Recombinant Human IL-2R beta/CD122 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Interleukin-2 receptor (IL-2R) also known as High-affinity IL-2 receptor subunit beta, IL-2…
Name : Recombinant Human IL-2R beta/CD122 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Interleukin-2 receptor (IL-2R) also known as High-affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta,…
Name : Recombinant Human IL-2R beta/CD122 Protein (ECD, mFc Tag)Biological Activity : Background : Interleukin-2 receptor (IL-2R) also known as High-affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and…
Name : Recombinant Human IL-2R beta/CD122 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : Interleukin-2 receptor (IL-2R) also known as High-affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta,…
Name : Recombinant Human CD10/Neprilysin ProteinBiological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of cells in the…
Name : Recombinant Human CD10/Neprilysin Protein (His Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of cells…
Name : Recombinant Human CD10/Neprilysin Protein (hFc Tag)Biological Activity : Background : The cluster of differentiation (CD) system is commonly used as cell markers in Immunophenotyping. Different kinds of cells…
Name : Human CCR2-Nanodisc Protein (Isoform B, His & Flag Tag)Biological Activity : Background : The C-C motif chemokine receptor-2 (CCR2) is a G protein-coupled receptor (GPCR), made up of…
Name : Recombinant Canine BAFF/BLyS/TNFSF13B Protein (hFc Tag)Biological Activity : Background : B lymphocyte stimulator (BLyS), also known as TNFSF13B, CD257 and BAFF, is a single-pass type II membrane protein,…
Name : Recombinant Human CCL5/RANTES ProteinBiological Activity : Background : Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such…
Name : Recombinant Human CCL5/RANTES Protein (His & mucin Tag)Biological Activity : Background : Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the…
Name : Recombinant Human CCL4/MIP-1 Protein (His Tag)Biological Activity : Background : CCL4 (C-C chemokine ligand 4), is a macrophage inflammatory protein with a chief effect in inflammation and immune-regulation,…
Name : Recombinant Human CCL28 Protein (His Tag)Biological Activity : Background : CCL28 chemokine is expressed by epithelial cells of various mucosal tissues. This chemokine binds to CCR3 and CCR10…
Name : Recombinant Human CCL27 Protein (His Tag)Biological Activity : Background : CCL27, also known as CTACK, is a small cytokine belonging to the CC chemokine family. Members of this…
Name : Recombinant Human CCL26/Eotaxin-3 ProteinBiological Activity : Background : The eotaxin subfamily of CC chemokines consists of eotaxin-1/CCL11, eotaxin-2/CCL24 and eotaxin-3/CCL26. All eotaxins induce the trafficking of eosinophils to…
Name : Recombinant Human CCL21/6Ckine ProteinBiological Activity : Background : Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such…
Name : Recombinant Human CCL20/MIP-3 Protein (His Tag)Biological Activity : Background : Chemokine (C-C motif) ligand 20 (CCL20) or liver activation regulated chemokine (LARC) or Macrophage Inflammatory Protein-3 (MIP3A) is…
Name : Recombinant Human CCL18/PARC/MIP-4 Protein (His Tag)Biological Activity : Background : CCL18 is a chemotactic cytokine involved in the pathogenesis and progression of various disorders, including cancer. Proof showed…
Name : Recombinant Human CCL14 Protein (aa 28-93, His Tag)Biological Activity : Background : CCL14 has an important biological role in other mammals by evolving under positive selection that has…
Name : Recombinant Canine ANGPTL1 Protein (hFc Tag)Biological Activity : Background : Angiopoietin-like protein 1 (ANGPTL1) has been reported to suppress migration and invasion in lung and breast cancer, acting…
Name : Recombinant Human CCL14 Protein (His Tag)Biological Activity : Background : CCL14 has an important biological role in other mammals by evolving under positive selection that has been lost…
Name : Recombinant Human CCK4/PTK7 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Protein tyrosine kinase 7 (PTK7) is a highly conserved but catalytically inactive receptor tyrosine kinase in the…
Name : Recombinant Human CCDC47 Protein (His Tag)Biological Activity : Background : CCDC47 gene is expressed at high level. The gene contains 16 distinct gt-ag introns. Transcription produces 9 different…
Name : Recombinant Human CCDC134 Protein (His Tag)Biological Activity : Background : Coiled-coil domain containing 134 (CCDC134) is a 229 amino acids secretory protein. Coiled-coil domain is a motif in…
Name : Recombinant Human CBR3 Protein (His Tag)Biological Activity : Background : CBR3, also known as hCBR3, belongs to the short-chain dehydrogenases/reductases (SDR) family. CBR3 is expressed in ovary, pancreas,…
Name : Recombinant Human Cbl-c Protein (His & GST Tag)Biological Activity : Background : CBL proteins, such as Cbl-c, are phosphorylated upon activation of a variety of receptors that signal…
Name : Recombinant Human CBFB Protein (His Tag)Biological Activity : Background : CBFB is the beta subunit of a heterodimeric core-binding transcription factor belonging to the PEBP2/CBF transcription factor family…
Name : Human CB2/CNR2 (Full Length) Protein-VLPBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : P34972NCBI Gene…
Name : Recombinant Human Cathepsin Z/CTSZ Protein (His Tag)Biological Activity : Background : Cathepsin Z (CTSZ), also known as Cathepsin X or CATX, belongs to the C1 family of lysosomal…
Name : Recombinant Human Cathepsin V Protein (His Tag)Biological Activity : Background : Cathepsin V (CTSV), also known as Cathepsin L2, CTSL2, and CATL2, is a member of the peptidase…
Name : Recombinant Canine Angiopoietin-like 7 Protein (His Tag)Biological Activity : Background : ANGPTL7 is a member of the Angiopoietin-like (ANGPTL) protein family that is composed of eight proteins (1-8). Increasing…
Name : Recombinant Human Cathepsin S Protein (His Tag), HPLC-verifiedBiological Activity : Background : Cathepsin S (CTSS), one of the lysosomal proteinases, has many important physiological functions in the nervous…
Name : Recombinant Human Cathepsin L Protein (His Tag), HPLC-verifiedBiological Activity : Background : Cathepsin L is a lysosomal cysteine protease that plays a major role in intracellular protein catabolism,…
Name : Recombinant Human Cathepsin H Protein (His Tag)Biological Activity : Background : Proinflammatory cytokines decreased the expression of CTSH in human islets and primary rat beta-cells, and overexpression of…
Name : Recombinant Human Cathepsin D Protein (His Tag), HPLC-verifiedBiological Activity : Background : Cathepsin D (CTSD), a well known lysosomal aspartyl protease and belongs to the peptidase C1 family,…
Name : Recombinant Human Cathepsin C Protein (His Tag)Biological Activity : Background : Cathepsins are proteases found in many types of cells conserved in all animals, which have a vital…
Name : Recombinant Human Cathepsin B Protein (His Tag), HPLC-verifiedBiological Activity : Background : Cathepsin B is a papain-family cysteine protease that is normally located in lysosomes, where it is…
Name : Recombinant Human Cathepsin A Protein (His Tag)Biological Activity : Background : Lysosomal carboxypeptidase, Cathepsin A (protective protein, CathA), is a component of the lysosomal multienzyme complex along with…
Name : Recombinant Human Catalase Protein (His Tag)Biological Activity : Background : Catalase is a ubiquitously expressed enzyme that catalyzes the decomposition of hydrogen peroxide to water and oxygen. It…
Name : Recombinant Human Caspase-7 Protein (His Tag)Biological Activity : Background : Caspase 7, also known as caspase-7 and MCH3, belongs to the cysteine-aspartic acid protease (caspase) family. Caspases play…
Name : Recombinant Human Caspase-14 Protein (His Tag)Biological Activity : Background : Caspase 14 is a member of the caspase family. Caspases are a kind of cysteine proteinase consisting of…
Name : Recombinant Canine Angiopoietin-like 7 Protein (hFc Tag)Biological Activity : Background : ANGPTL7 is a member of the Angiopoietin-like (ANGPTL) protein family that is composed of eight proteins (1-8). Increasing…
Name : Recombinant Human CASK ProteinBiological Activity : Background : Peripheral plasma membrane protein CASK, also known as calcium/calmodulin-dependent serine protein kinase, CASK and LIN2, is a nucleus, cytoplasm and…
Name : Recombinant Human CASK Protein (His & GST Tag)Biological Activity : Background : Peripheral plasma membrane protein CASK, also known as calcium/calmodulin-dependent serine protein kinase, CASK and LIN2, is…
Name : Recombinant Human Casein Kinase 1 alpha Protein (GST Tag)Biological Activity : Background : Casein kinase I isoform alpha, also known as CKI-alpha, CK1 and CSNK1A1, is a cytoplasm…
Name : Recombinant Human CART ProteinBiological Activity : Background : In RNAseq data from human islet donors, CARTPT expression levels correlated with insulin, exocytosis genes and key beta-cell transcription factors. Insufficient insulin…
Name : Recombinant Human CART Protein (mFc Tag)Biological Activity : Background : In RNAseq data from human islet donors, CARTPT expression levels correlated with insulin, exocytosis genes and key beta-cell transcription factors.…
Name : Recombinant Human CARKL Protein (His & GST Tag)Biological Activity : Background : CARKL, also known as SHPK, is a nonprotein kinase of glucose metabolism. CARKL has weak homology…
Name : Recombinant Human CARHSP1 Protein (His Tag)Biological Activity : Background : CARHSP1 is a biomarker for diabetic complications. Adenovirus-mediated CARHSP1 overexpression and siRNA-mediated knockdown experiments were performed to characterize…
Name : Recombinant Human Cardiotrophin 1 ProteinBiological Activity : Background : CTF1 is the first HOX11 protein partner identified that plays an important role in hematopoietic precursor cell immortalization. CTF1…
Name : Recombinant Human Cardiotrophin 1 Protein (hFc Tag)Biological Activity : Background : CTF1 is the first HOX11 protein partner identified that plays an important role in hematopoietic precursor cell…
Name : Recombinant Human Carboxypeptidase M Protein (His Tag)Biological Activity : Background : Carboxypeptidase M, also known as CPM, is a membrane-bound arginine/lysine carboxypeptidase which is a member of the…
Name : Recombinant Canine Angiopoietin-2/ANGPT2 Protein (His Tag)Biological Activity : Background : Angiopoietin-2 (ANG 2, or ANGPT2), is a member of the ANG family, which plays an important role in…
Name : Recombinant Human Carboxypeptidase E/CPE Protein (His Tag)Biological Activity : Background : Carboxypeptidase E (CPE), also known as Carboxypeptidase H, is a peripheral membrane protein and a zinc metallocarboxypeptidase,…
Name : Recombinant Human Carboxypeptidase E/CPE Protein (hFc Tag)Biological Activity : Background : Carboxypeptidase E (CPE), also known as Carboxypeptidase H, is a peripheral membrane protein and a zinc metallocarboxypeptidase,…
Name : Recombinant Human Carboxypeptidase A Protein (His Tag)Biological Activity : Background : Carboxypeptidase A1 (CPA1)is secreted as a pancreatic procarboxypeptidase, and cleaves the C-terminal amide or ester bond of…
Name : Recombinant Human carboxylesterase 2/CES2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Carboxylesterase 2 (CES2) is a member of the carboxylesterase family and belongs to the multigene family.…
Name : Recombinant Human Carbonic Anhydrase XIV/CA14 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : The Carbonic Anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion…
Name : Recombinant Human Carbonic Anhydrase XIV/CA14 Protein (His Tag)Biological Activity : Background : The Carbonic Anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group…
Name : Recombinant Human carbonic anhydrase XII/CA12 Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered…
Name : Recombinant Human carbonic anhydrase XII/CA12 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that…
Name : Recombinant Human Carbonic Anhydrase VII Protein (His Tag)Biological Activity : Background : Carbonic Anhydrase 7, also known as carbonate dehydratase VII, Carbonic Anhydrase VII, CA-VII and CA7, is…
Name : Recombinant Human Carbonic Anhydrase VB Protein (His Tag)Biological Activity : Background : Carbonic Anhydrase 5B, also known as carbonate dehydratase VB, Carbonic Anhydrase VB, CA-VB and CA5B, is…
Name : Recombinant Canine ALK-1 Protein (hFc Tag)Biological Activity : Background : Activin A receptor, type II-like 1 (ACVRL1), also known as ALK-1 (activin receptor-like kinase 1), is an endothelial-specific…
Name : Recombinant Human Carbonic Anhydrase IX/CA9 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Carbonic Anhydrases IX (CA IX), also known as membrane antigen MN…
Name : Recombinant Human Carbonic Anhydrase IX/CA9 Protein (ECD, hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Carbonic Anhydrases IX (CA IX), also known as membrane antigen MN…
Name : Recombinant Human Carbonic Anhydrase IX/CA9 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Carbonic Anhydrases IX (CA IX), also known as membrane antigen MN or CA9, is…
Name : Recombinant Human Carbonic Anhydrase IX/CA9 Protein (hFc Tag)Biological Activity : Background : Carbonic Anhydrases IX (CA IX), also known as membrane antigen MN or CA9, is a member…
Name : Recombinant Human Carbonic Anhydrase IV/CA4 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : The Carbonic Anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion…
Name : Recombinant Human Carbonic Anhydrase IV/CA4 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The Carbonic Anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic…
Name : Recombinant Human Carbonic Anhydrase III Protein (His Tag)Biological Activity : Background : Carbonic Anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze…
Name : Recombinant Human Carbonic Anhydrase II/CA2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The Carbonic Anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic…
Name : Recombinant Human CXADR/CAR Protein (His Tag), HPLC-verifiedBiological Activity : Background : CXADR (coxsackie virus and adenovirus receptor), also known as CAR, is a type I transmembrane glycoprotein belonging…
Name : Recombinant Human CXADR/CAR Protein (His & hFc Tag)Biological Activity : Background : CXADR (coxsackie virus and adenovirus receptor), also known as CAR, is a type I transmembrane glycoprotein…
Name : Recombinant Canine ACVR1 Protein (His Tag)Biological Activity : Background : ALK-2, also termed as ACVR1, was initially identified as an activin type I receptor because of its ability…
Name : Recombinant Human CAPG ProteinBiological Activity : Background : CAPG, also known as actin Regulatory Protein CAPG, is a a member of the gelsolin/villin family. Members of this family…
Name : Recombinant Human CANT1 Protein (His Tag)Biological Activity : Background : CANT1(calcium activated nucleotidase 1) belongs to the apyrase family. Apyrase is a calcium-activated plasma membrane-bound enzyme (magnesium can…
Name : Recombinant Human CANT1 Protein (hFc Tag)Biological Activity : Background : CANT1(calcium activated nucleotidase 1) belongs to the apyrase family. Apyrase is a calcium-activated plasma membrane-bound enzyme (magnesium can…
Name : Recombinant Human CAMKV Protein (His & GST Tag)Biological Activity : Background : CaM kinase-like vesicle-associated protein, also known as CAMKV, is a peripheral membrane protein and Cytoplasmic vesicle…
Name : Recombinant Human CAMKIV Protein (GST Tag)Biological Activity : Background : Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) belongs to the serine/threonine protein kinase family, and to the Ca2+/calmodulin-dependent protein…
Name : Recombinant Human CaMKII beta/CAMK2B Protein (His & GST Tag)Biological Activity : Background : Calcium/calmodulin-dependent protein kinase II beta (CAMK2B) is a member of the serine/threonine protein kinase family…
Name : Recombinant Human CaMKII alpha/CAMK2A Protein (GST Tag)Biological Activity : Background : Ca2+/calmodulin-dependent protein kinase2A (CAMK2A) belongs to the serine/threonine protein kinase family and, together with other 28 different…
Name : Recombinant Human CaMKI gamma/CAMK1G Protein (His & GST Tag)Biological Activity : Background : Calmodulin-Dependent Protein Kinase (CaM Kinase) is a kind of protein phosphorylate multiple downstream targets. Concentration…
Name : Recombinant Human CAMKI ProteinBiological Activity : Background : Calcium/calmodulin-dependent protein kinase orCaM kinases are serine/threonine-specific protein kinasesthat are primarily regulated by the Calcium/calmodulin complex. These kinases show a…
Name : Recombinant Human CAMK1D Protein (GST Tag)Biological Activity : Background : Calcium/calmodulin-dependent protein kinase orCaM kinases are serine/threonine-specific protein kinasesthat are primarily regulated by the Calcium/calmodulin complex. These kinases…
Name : Recombinant Canine ACVR1 Protein (hFc Tag)Biological Activity : Background : ALK-2, also termed as ACVR1, was initially identified as an activin type I receptor because of its ability…
Name : Recombinant Human Calumenin Protein (His Tag)Biological Activity : Background : Calumenin belongs to the CREC family. It contains 6 EF-hand domains. Calumenin is expressed in skeletal muscle (at…
Name : Recombinant Human Calsequestrin 1 ProteinBiological Activity : Background : Calsequestrin-1 is an isoform of calsequestrin. Calsequestrin is a calcium-binding protein of the sarcoplasmic reticulum. It helps hold calcium…
Name : Recombinant Human Calreticulin/CALR ProteinBiological Activity : Background : Calreticulin is a multifunctional protein. It acts as a main Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum.…
Name : Recombinant Human Calreticulin/CALR Protein (His Tag), HPLC-verifiedBiological Activity : Background : Calreticulin is a multifunctional protein. It acts as a main Ca(2+)-binding (storage) protein in the lumen of…
Name : Recombinant Human Calreticulin/CALR Protein (hFc Tag)Biological Activity : Background : Calreticulin is a multifunctional protein. It acts as a main Ca(2+)-binding (storage) protein in the lumen of the…
Name : Recombinant Human Calnexin Protein (hFc Tag)Biological Activity : Background : Calnexin is a calcium-binding protein that belongs to the calreticulin family. It interacts with newly synthesized glycoproteins in…
Name : Recombinant Human CALML5 Protein (His & GST Tag)Biological Activity : Background : Calmodulin-like protein 5, also known as Calmodulin-like skin protein, CALML5 and CLSP, is a protein which…
Name : Recombinant Human CALML3 Protein (His Tag)Biological Activity : Background : Calmodulin-like protein 3 (CALML3) is similar to that of authentic calmodulin and may actually compete with calmodulin by…
Name : Recombinant Human CALM2 Protein (His Tag)Biological Activity : Background : Calmodulin 2, also known as CALM2, is a calmodulin. Calmodulin 2 mediates the control of a large number…
Name : Recombinant Human Calcitonin receptor Protein (ECD, hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant C.perfringens C. Perfringens Neuraminidase Protein (His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Measured by its ability to cleave a fluorogenic substrate, 2'-(4-Methylumbelliferyl)-α-D-N-acetylneuraminic acid. The…
Name : SARS-CoV-2 (2019-nCoV) Spike S1+S2 ECD-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the…
Name : Recombinant Human Calcitonin receptor Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human Calcineurin B/PPP3R1 Protein (His Tag)Biological Activity : Background : PPP3R1 belongs to the calcineurin regulatory subunit family. It is a regulatory subunit of calcineurin. Calcineurin is…
Name : Recombinant Human Calcineurin A/PPP3CA Protein (His Tag)Biological Activity : Background : PPP3CA, also known as protein phosphatase 2B, is a member of the PPP phosphatase family, PP-2B subfamily.…
Name : Recombinant Human CALCB Protein (mFc Tag)Biological Activity : Background : CALCB, also known as CGPR and calcitonin 2, belongs to the calcitonin family. CALCB is a calcitonin (CT)…
Name : Recombinant Human CADM4 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Immunoglobulin superfamily member 4C (IGSF4C), also known as CADM4 or NECL-4, is an immunoglobulin (Ig) superfamily…
Name : Recombinant Human CADM4 Protein (hFc Tag)Biological Activity : Background : Immunoglobulin superfamily member 4C (IGSF4C), also known as CADM4 or NECL-4, is an immunoglobulin (Ig) superfamily molecule showing…
Name : Recombinant Human CADM3 Protein (His Tag)Biological Activity : Background : Cell Adhesion Molecules (CAMs) are proteins located on the cell surface involved with the binding with other cells…
Name : Recombinant Human CADM2 Protein (ECD, His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human CADM1 Protein (His Tag)Biological Activity : Background : Members of the immunoglobulin superfamily often play key roles in intercellular adhesion. IGSF4 is a novel immunoglobulin (Ig)-like…
Name : Recombinant Human Cadherin 8 Protein (His Tag)Biological Activity : Background : Cadherins are integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Type I cadherin proteins are composed of…
Name : Recombinant Bovine viral diarrhea virus (BVDV) glycoprotein E2Biological Activity : Background : Biological Activity : Testing in progressExpression Host : BVDVSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant Human Cadherin-17 Protein (ECD, His & AVI Tag), BiotinylatedBiological Activity : Background : Cadherin-17 or LI-cadherin is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated…
Name : Recombinant Human Cadherin-17 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Cadherin-17 or LI-cadherin is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Cadherin-17/LI-cadherin is…
Name : Recombinant Human Cadherin-16 Protein (His Tag)Biological Activity : Background : KSP-Cadherin/Cadherin-16 is a member of the cadherin superfamily, calcium-dependent, membrane-associated glycoproteins. The protein consists of an extracellular domain…
Name : Recombinant Human Cadherin-11 Protein (His Tag), HPLC-verifiedBiological Activity : Background : A mesenchymal marker, Cadherin-11's (CDH11) gene is situated on chromosome 16q22.1. CDH11 is a type II atypical…
Name : Recombinant Human CABP5 Protein (His Tag)Biological Activity : Background : CABP3, also known as CABP5, belongs to a subfamily of calcium binding proteins, which share similarity to calmodulin.…
Name : Recombinant Human Carbonic Anhydrase 8/CA8 Protein (His Tag)Biological Activity : Background : The Carbonic Anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group…
Name : Recombinant Human CA5A Protein (His Tag)Biological Activity : Background : Carbonic Anhydrase 5A, mitochondrial, also known as Carbonate dehydratase VA, Carbonic Anhydrase VA, CA-VA and CA5A, is a…
Name : Recombinant Human CA13 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The Carbonic Anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and…
Name : Recombinant Human CA125/MUC16 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Immobilized Recombinant Human MSLN / Mesothelin Protein(Cat:13128-HNCH) at 2 μg/ml (100 μl/well) can…
Name : Recombinant Human Carbonic Anhydrase X ProteinBiological Activity : Background : Carbonic Anhydrase X, also called Carbonic Anhydrase - related protein X (CARPX) and CA1, belongs to the CA…
Name : Recombinant Brazil nut Ber e 1 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Brazil nutSource : E. coliTag : Protein Accession No.…
Name : Recombinant Human Carbonic Anhydrase X Protein (His Tag)Biological Activity : Background : Carbonic Anhydrase X, also called Carbonic Anhydrase - related protein X (CARPX) and CA1, belongs to…
Name : Recombinant Human Complement C7 Protein (His Tag)Biological Activity : Background : Complement component 7 is a component of the complement system. It belongs to the complement C6/C7/C8/C9 family.…
Name : Recombinant Human Complement C7 Protein (hFc Tag)Biological Activity : Background : Complement component 7 is a component of the complement system. It belongs to the complement C6/C7/C8/C9 family.…
Name : Recombinant Human C6 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : AAA59668.1NCBI…
Name : Recombinant Human Complement C5 Protein (Flag Tag)Biological Activity : Background : C5a is a protein fragment released from complement component C5. This 74 amino acid peptide in humans…
Name : C5 Protein, Human, Recombinant (His & FLAG Tag)Biological Activity : Background : C5a is a protein fragment released from complement component C5. This 74 amino acid peptide in…
Name : Recombinant Human Complement C5 Protein (C5a), HPLC-verifiedBiological Activity : Background : C5a is a protein fragment released from complement component C5. This 74 amino acid peptide in humans…
Name : Recombinant Human Complement C2 Protein (His Tag)Biological Activity : Background : Complement component C2 is part of the classical complement pathway which plays a major role in innate…
Name : Recombinant Human Complement C2 Protein (hFc Tag)Biological Activity : Background : Complement component C2 is part of the classical complement pathway which plays a major role in innate…
Name : Recombinant Human Complement C1s Protein (His Tag), HPLC-verifiedBiological Activity : Background : Complement is an integral component of the adaptive and innate immune systems and represents one of…
Name : Recombinant Bovine Enterokinase Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : BovineSource : YeastTag : Protein Accession No. : NP_776864.1NCBI Gene…
Name : Recombinant Human HABP1/C1qBP/gC1qR Protein (His Tag)Biological Activity : Background : Hyaluronan binding protein 1 (HABP1), also known as p32 or gC1qR, is a ubiquitously expressed multifunctional phospho-protein implicated…
Name : Recombinant Human C1qB Protein (His Tag)Biological Activity : Background : Complement Component 1, q subcomponent (C1q) associates with C1r and C1s in order to yield the first component…
Name : Recombinant Human C1orf33/MRTO4 Protein (His Tag)Biological Activity : Background : MRTO4 (MRT4 Homolog, Ribosome Maturation Factor) is a Protein Coding gene. MRTO4, also known as MRT4, belongs to…
Name : Recombinant Human C1D Protein (GST Tag)Biological Activity : Background : C1D nuclear receptor corepressor belongs to the C1D family. It is a DNA binding and apoptosis-inducing protein.C1D nuclear…
Name : Recombinant Human C1 inhibitor/C1-INH Protein (His Tag), HPLC-verifiedBiological Activity : Background : Plasma protease C1 inhibitor, also known as C1-inhibiting factor, C1-INH, C1 esterase inhibitor, SERPING1 and C1IN,…
Name : Recombinant Human C-Reactive Protein Protein, Amine-Labeled BiotinylatedBiological Activity : Background : C-reactive protein (CRP) is synthesized by the liver in response to factors released by fat cells. It…
Name : Recombinant Human C-Reactive Protein Protein, HPLC-verifiedBiological Activity : Background : C-reactive protein (CRP) is synthesized by the liver in response to factors released by fat cells. It is…
Name : Recombinant Human C-Reactive Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : C-reactive protein (CRP) is synthesized by the liver in response to factors released by…
Name : Recombinant Human TPO-R Protein (His Tag), HPLC-verifiedBiological Activity : Background : CD11, also known as c-MPL, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor…
Name : Recombinant Human c-MET/HGFR Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Hepatocyte growth factor receptor (HGFR), also known as c-Met or mesenchymal-epithelial transition factor…
Name : Recombinant Bos domesticus Bos d 2 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Bos domesticusSource : E. coliTag : Protein Accession No.…
Name : Recombinant Human c-MET/HGFR Protein (aa 956-1390, His & GST Tag)Biological Activity : Background : Hepatocyte growth factor receptor (HGFR), also known as c-Met or mesenchymal-epithelial transition factor (MET),…
Name : Recombinant Human c-MET/HGFR Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Hepatocyte growth factor receptor (HGFR), also known as c-Met or mesenchymal-epithelial transition factor (MET), is a…
Name : Recombinant Human c-MET/HGFR Protein (ECD, His & hFc Tag), HPLC-verifiedBiological Activity : Background : Hepatocyte growth factor receptor (HGFR), also known as c-Met or mesenchymal-epithelial transition factor (MET),…
Name : Recombinant Human c-MET/HGFR Protein (ECD, hFc Tag)Biological Activity : Background : Hepatocyte growth factor receptor (HGFR), also known as c-Met or mesenchymal-epithelial transition factor (MET), is a receptor…
Name : Recombinant Human c-Kit Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : C-Kit is a type 3 transmembrane receptor for MGF (mast cell growth factor,…
Name : Recombinant Human c-Kit Protein (aa 540-972, His & GST Tag)Biological Activity : Background : C-Kit is a type 3 transmembrane receptor for MGF (mast cell growth factor, also…
Name : Recombinant Human c-Kit Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : C-Kit is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as…
Name : Recombinant Human c-Kit Protein (aa 50-190, His Tag)Biological Activity : Background : C-Kit is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as…
Name : Recombinant Human c-Kit Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : C-Kit is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem…
Name : Recombinant Human BVES Protein (GST Tag)Biological Activity : Background : Blood vessel epicardial substance (BVES), or POPDC1, is a tight junction-associated transmembrane protein that modulates epithelial-to-mesenchymal transition (EMT)…
Name : Recombinant Blomia tropicalis Blo t 5 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : Blomia tropicalisSource : YeastTag : Protein Accession…
Name : Recombinant Human Butyrylcholinesterase Protein (His Tag)Biological Activity : Background : Butyrylcholinesterase (BCHE), also known as cholinesterase or BuChE, is an enzyme defined as "pseudo" or "non-neuronal" cholinesterase. Butyrylcholinesterase…
Name : Recombinant Human BTN3A3 Protein (His Tag)Biological Activity : Background : The three butyrophilin BTN3A molecules, BTN3A1, BTN3A2, and BTN3A3, are members of the B7/butyrophilin-like group of Ig superfamily…
Name : Recombinant Human BTN3A3 Protein (mFc Tag)Biological Activity : Background : The three butyrophilin BTN3A molecules, BTN3A1, BTN3A2, and BTN3A3, are members of the B7/butyrophilin-like group of Ig superfamily…
Name : Recombinant Human BTN3A2 Protein (His Tag)Biological Activity : Background : The three butyrophilin BTN3A molecules, BTN3A1, BTN3A2, and BTN3A3, are members of the B7/butyrophilin-like group of Ig superfamily…
Name : Recombinant Human CD277/BTN3A1 Protein (ECD), HPLC-verifiedBiological Activity : Background : BTN3A1 has the structure of a type I receptor of the Ig superfamily and is part of a…
Name : Recombinant Human CD277/BTN3A1 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : BTN3A1 has the structure of a type I receptor of the Ig superfamily and is part…
Name : Recombinant Human CD277/BTN3A1 Protein (His Tag)Biological Activity : Background : BTN3A1 has the structure of a type I receptor of the Ig superfamily and is part of a…
Name : Recombinant Human CD277/BTN3A1 Protein (ECD, hFc Tag)Biological Activity : Background : BTN3A1 has the structure of a type I receptor of the Ig superfamily and is part of…
Name : Recombinant Human BTN1A1 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag :…
Name : Recombinant Human BTN1A1 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant Blomia tropicalis Blo t 21 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : Blomia tropicalisSource : HEK293 CellsTag : Protein…
Name : Recombinant Human BTN1A1 Protein (ECD, hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human BTLA Protein (His & AVI Tag), Biotinylated, isoform 1,HPLC-verifiedBiological Activity : Background : BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates…
Name : Recombinant Human BTLA Protein (isoform 1, mFc Tag)Biological Activity : Background : BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates immune responses. As…
Name : Recombinant Human BTLA Protein (isoform1, His Tag), HPLC-verifiedBiological Activity : Background : BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates immune responses. As…
Name : Recombinant Human BTLA Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates immune responses. As such,…
Name : Recombinant Human BTLA Protein (ECD, mFc Tag)Biological Activity : Background : BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates immune responses. As such,…
Name : Recombinant Human BTLA Protein (hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates immune…
Name : Recombinant Human BTLA Protein (ECD, mFc Tag)Biological Activity : Background : BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates immune responses. As such,…
Name : Recombinant Human BTLA Protein (His Tag), HPLC-verifiedBiological Activity : Background : BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates immune responses. As such,…
Name : Recombinant Human BTLA Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates immune responses. As such,…
Name : Recombinant Blomia tropicalis Blo t 21 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : Blomia tropicalisSource : E. coliTag : Protein…
Name : Recombinant Human BTK Protein (His Tag)Biological Activity : Background : Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells.…
Name : Recombinant Human BTD Protein (His Tag), HPLC-verifiedBiological Activity : Background : Biotinidase, also known as biotinase and BTD, is a ubiquitous mammalian cell enzyme which expressed at high…
Name : Recombinant Human BST2 Protein (His Tag)Biological Activity : Background : BST2 was frequently overexpressed in GC tissues compared with the adjacent non-tumorous tissues, and high BST2 expression was correlated with tumor…
Name : Recombinant Human BST2 Protein (hFc Tag)Biological Activity : Background : BST2 was frequently overexpressed in GC tissues compared with the adjacent non-tumorous tissues, and high BST2 expression was correlated with tumor…
Name : Recombinant Human Brk Protein (GST Tag)Biological Activity : Background : Tyrosine kinase (PTKs) is a protein that carries out tyrosine phosphorylation, which play a fundamental role in cell…
Name : Recombinant Human BPIFB1 Protein (His Tag)Biological Activity : Background : BPIFB1, also known as LPLUNC1, belongs to the BPI/LBP/Plunc superfamily, plunc family. BPIFB1 may be involved in the…
Name : Recombinant Human BPIFA2 Protein (His Tag)Biological Activity : Background : C20orf70 belongs to the BPI/LBP/Plunc superfamily, Plunc family. PLUNC family is comprised by mucosal secretory proteins that are…
Name : Recombinant Human BPIFA2 Protein (hFc Tag)Biological Activity : Background : C20orf70 belongs to the BPI/LBP/Plunc superfamily, Plunc family. PLUNC family is comprised by mucosal secretory proteins that are…
Name : Recombinant Human BPI Protein (His Tag)Biological Activity : Background : Bactericidal/permeability-increasing protein is a member of the BPI/LBP/Plunc superfamily and BPI/LBP family. It is a cationic protein which…
Name : Recombinant Human BPHL Protein (His Tag)Biological Activity : Background : BPHL is a member of the serine protease family. BPHL is expressed large quantities in liver and kidney…
Name : Recombinant Blomia tropicalis Blo t 2 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : Blomia tropicalisSource : HEK293 CellsTag : Protein…
Name : Recombinant Human BOLA1 Protein (His Tag)Biological Activity : Background : BOLA1 is a mitochondrial protein that counterbalances the effect of L-buthionine-(S,R)-sulfoximine (BSO)-induced glutathione (GSH) depletion on the mitochondrial thiol…
Name : Recombinant Human BNIP3L ProteinBiological Activity : Background : The deletion of BNIP3L results in retention of mitochondria during lens fiber cell remodeling, and that deletion of BNIP3L also results in the retention…
Name : Recombinant Human BMPRIB Protein (aa 149-502, His & GST Tag)Biological Activity : Background : BMPR1B(bone morphogenetic protein receptor, type IB), also known as ALK6, is a member of…
Name : Recombinant Human BMPRIB Protein (hFc Tag)Biological Activity : Background : BMPR1B(bone morphogenetic protein receptor, type IB), also known as ALK6, is a member of the bone morphogenetic protein…
Name : Recombinant Human BMPR2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The bone morphogenetic protein type II receptor (BMPR-II, or BMPR2), a receptor for the transforming growth factor…
Name : Recombinant Human BMPR2 Protein (His & hFc Tag), HPLC-verifiedBiological Activity : Background : The bone morphogenetic protein type II receptor (BMPR-II, or BMPR2), a receptor for the transforming…
Name : Recombinant Human BMPR1A/ALK-3 Protein (His Tag)Biological Activity : Background : Activin receptor-Like Kinase 3 (ALK-3), also known as Bone Morphogenetic Protein Receptor, type IA (BMPR1A), is a type…
Name : Recombinant Human BMPR1A/ALK-3 Protein (ECD, hFc Tag)Biological Activity : Background : Activin receptor-Like Kinase 3 (ALK-3), also known as Bone Morphogenetic Protein Receptor, type IA (BMPR1A), is a…
Name : Recombinant Human BMP5 Protein (hFc Tag)Biological Activity : Background : Bone Morphogenetic Protein 5 (BMP-5) is a member of the structurally and functionally related bone morphogenetic proteins (BMPs)…
Name : Recombinant Human BMP4 Protein (E399D)Biological Activity : Background : BMP4 (bone morphogenetic protein-4)-directed differentiation of human embryonic stem cells (ESCd). Autophagy is a conserved catabolic process with complicated roles…
Name : Recombinant Blomia tropicalis Blo t 1 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : Blomia tropicalisSource : YeastTag : Protein Accession…
Name : Recombinant Human, Mouse, Rat, Rhesus, Canine BMP-2 ProteinBiological Activity : Background : BMP-2 protein, like other bone morphogenetic proteins, plays an important role in the development of bone…
Name : Recombinant Human, Mouse, Rat, Rhesus, Canine BMP-2 Protein (hFc Tag)Biological Activity : Background : BMP-2 protein, like other bone morphogenetic proteins, plays an important role in the development…
Name : Recombinant Human BMF Protein (His Tag)Biological Activity : Background : BMF(Bcl2 modifying factor) belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act…
Name : Recombinant Human BLVRB Protein (His Tag)Biological Activity : Background : Biliverdin reductase (hBVR) is a serine/threonine kinase that catalyzes reduction of the heme oxygenase (HO) activity product, biliverdin,…
Name : Recombinant Human BLOC1S2 Protein (GST Tag)Biological Activity : Background : BLOC1S2, also known as BLOS2, belongs to the BLOC1S2 family. It is a component of BLOC-1 complex. The…
Name : Recombinant Human BLNK Protein (His Tag)Biological Activity : Background : B-cell linker protein, also known as B-cell adapter containing a SH2 domain protein, B-cell adapter containing a Src…
Name : Recombinant Human BLK Protein (GST Tag)Biological Activity : Background : Tyrosine-protein kinase Blk, also known as B lymphocyte kinase, p55-Blk and BLK, is a member of theprotein kinase…
Name : Recombinant Human BLBP ProteinBiological Activity : Background : BLBP, also known as FABP7, is a brain fatty acid binding protein. Fatty acid binding proteins (FABPs) are a family…
Name : Recombinant Human BIN2 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : E. coliTag : Protein Accession No. : Q9UBW5-1NCBI…
Name : Recombinant Human BIN1 Protein (His Tag)Biological Activity : Background : Amphiphysin 2, also named bridging integrator-1 (BIN1) or SH3P9, Amphiphysin2/BIN1 is a crescent-shaped N-BAR protein playing a key…
Name : Recombinant Blattella germanica Bla g 2 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Blattella germanicaSource : P.pastorisTag : Protein Accession No. :…
Name : SARS-CoV-2 (2019-nCoV) RNA-dependent RNA polymerase / RDRP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : SARS-CoV-2Source : Baculovirus-Insect CellsTag : Protein…
Name : Recombinant Human Bim Protein (His Tag)Biological Activity : Background : BCL2L11, also known as Bim, belongs to the BCL-2 protein family. Members of this family form hetero- or…
Name : Recombinant Human Bikunin/AMBP Protein (His Tag), HPLC-verifiedBiological Activity : Background : The AMBP gene encodes two plasma glycoproteins: A1M, an immunosuppressive lipocalin, and bikunin, a member of plasma…
Name : Recombinant Human Bikunin/AMBP Protein (His Tag)Biological Activity : Background : The AMBP gene encodes two plasma glycoproteins: A1M, an immunosuppressive lipocalin, and bikunin, a member of plasma serine…
Name : Recombinant Human Bikunin/AMBP Protein (mFc Tag)Biological Activity : Background : The AMBP gene encodes two plasma glycoproteins: A1M, an immunosuppressive lipocalin, and bikunin, a member of plasma serine…
Name : Recombinant Human Biglycan Protein (His Tag)Biological Activity : Background : Biglycan, also known as PG-S1 and BGN, is a a small leucine-rich repeat proteoglycan (SLRP). It can be…
Name : Recombinant Human BID ProteinBiological Activity : Background : The BH3 interacting domain death agonist (BID) is a pro-apoptotic member of the Bcl-2 protein family, which contains only the…
Name : Recombinant Human Betacellulin Protein (hFc Tag)Biological Activity : Background : Betacellulin(BTC) is a member of the epidermal growth factor (EGF) family. These soluble proteins are ligands for one…
Name : Recombinant Human beta Defensin 3/DEFB103A Protein (His Tag)Biological Activity : Background : Beta-defensin 3 is a member of the defensin family. Defensin family is comprised by microbicidal and…
Name : Recombinant Human beta Defensin 1/DEFB1 Protein (hFc Tag)Biological Activity : Background : The DEFB1 gene, encoding for the constitutively expressed human beta-defensin 1 (hBD1) antimicrobial peptide is a…
Name : Recombinant Human beta-Catenin Protein (His & GST Tag)Biological Activity : Background : beta-Catenin, also known as CTNNB1, is a member of the armadillo family of proteins. These proteins…
Name : Recombinant Blattella germanica Bla g 1 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Blattella germanicaSource : P.pastorisTag : Protein Accession No. :…
Name : Recombinant Human beta-Catenin Protein (His Tag), HPLC-verifiedBiological Activity : Background : beta-Catenin, also known as CTNNB1, is a member of the armadillo family of proteins. These proteins have…
Name : Recombinant Human beta Amylase/AMY2B Protein (His Tag)Biological Activity : Background : Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, and thus catalyze the first…
Name : Recombinant Human beta Amylase/AMY2B Protein (hFc Tag)Biological Activity : Background : Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, and thus catalyze the first…
Name : Recombinant Human BCMA Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 17 (TNFRSF17), also known as B cell…
Name : Recombinant Human BCMA Protein (ECD, hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 17 (TNFRSF17), also known as B cell…
Name : Recombinant Human BCMA Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 17 (TNFRSF17), also known as B cell maturation…
Name : Recombinant Human BCMA Protein (mFc Tag), HPLC-verifiedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 17 (TNFRSF17), also known as B cell maturation antigen (BCMA) or…
Name : Recombinant Human BCMA Protein (ECD, rFc Tag), HPLC-verifiedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 17 (TNFRSF17), also known as B cell maturation antigen (BCMA)…
Name : Recombinant Human BCMA Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 17 (TNFRSF17), also known as B cell maturation antigen (BCMA)…
Name : Recombinant Human BCMA Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 17 (TNFRSF17), also known as B cell maturation antigen (BCMA)…
Name : Recombinant Betula verrucosa Bet v 2 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Betula verrucosaSource : P.pastorisTag : Protein Accession No. :…
Name : Recombinant Human BCL6 Protein (aa 1-150, His & Trx Tag)Biological Activity : Background : The protein encoded by this gene is an evolutionarily conserved 95-kDa protein containing six…
Name : Recombinant Human BCL2L12 Protein (GST Tag)Biological Activity : Background : BCL2-like 12 (BCL2L12 ) is a new member of the apoptosis-related BCL2 gene family, members of which are…
Name : Recombinant Human Bcl2A1 Protein (His Tag)Biological Activity : Background : B-cell lymphoma 2-related protein A1 (BCL2A1) is a member of the BCL-2 family of anti-apoptotic proteins that confers…
Name : Recombinant Human BCL-xL/BCL2L1 Protein (His Tag)Biological Activity : Background : B-cell lymphoma-extra large (Bcl-xl) is a transmembrane molecule in the mitochondria. Bcl-xL (BCL2L1), belongs to the Bcl-2 family.…
Name : Recombinant Human Bcl-W Protein (His Tag)Biological Activity : Background : Beta1,4-Galactosyltransferase-I (B4GALT1), one of seven beta1,4-galactosyltransferases, is an enzyme commonly found in the trans-Golgi complex that adds galactose…
Name : Recombinant Human Bcl-2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : BCL2 (B-cell leukemia/lymphoma 2, N-Histidine-tagged), also known as Bcl-2, belongs to the Bcl-2 family. Bcl-2 family proteins…
Name : Recombinant Human Bcl-2 Protein (His Tag)Biological Activity : Background : BCL2 (B-cell leukemia/lymphoma 2, N-Histidine-tagged), also known as Bcl-2, belongs to the Bcl-2 family. Bcl-2 family proteins regulate…
Name : Recombinant Human BCCIP ProteinBiological Activity : Background : BCCIP was originally identified as a BRCA2 and CDKN1A interacting protein that has been implicated in maintenance of genomic stability,…
Name : Recombinant Human BCCIP Protein (His & GST Tag)Biological Activity : Background : BCCIP was originally identified as a BRCA2 and CDKN1A interacting protein that has been implicated in…
Name : Recombinant Human BCAM Protein (His Tag), HPLC-verifiedBiological Activity : Background : The Lutheran (Lu) blood group and basal cell adhesion molecule (BCAM) antigens are both carried by 2…
Name : Recombinant Betula verrucosa Bet v 2 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Betula verrucosaSource : E. coliTag : Protein Accession No.…
Name : Recombinant Human BCAM Protein (hFc Tag)Biological Activity : Background : The Lutheran (Lu) blood group and basal cell adhesion molecule (BCAM) antigens are both carried by 2 glycoprotein…
Name : Recombinant Human BCA-1/CXCL13 ProteinBiological Activity : Background : The chemokine CXCL13, also known as BCA-1 (B-cell-attracting chemokine-1) or BLC (B-lymphocyte chemoattractant), which belongs to the CXC chemokine family.…
Name : Recombinant Human BBOX1 Protein (His & GST Tag)Biological Activity : Background : BBOX1, also known as gamma-BBH, belongs to thegamma-BBH/TMLD family. It is highly expressed in kidney and…
Name : Recombinant Human BAMBI Protein (His Tag)Biological Activity : Background : BMP and activin membrane-bound inhibitor (BAMBI) is a transmembrane glycoprotein that is a pseudoreceptor of type 1 receptors.…
Name : Recombinant Human BAFFR/TNFRSF13C Protein (hFc & AVI Tag), BiotinylatedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) also known as B-cell-activating factor receptor (BAFFR)…
Name : Recombinant Human BAFFR/TNFRSF13C Protein (His Tag), HPLC-verifiedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) also known as B-cell-activating factor receptor (BAFFR) and CD268…
Name : Recombinant Human BAFFR/TNFRSF13C Protein (hFc Tag), HPLC-verifiedBiological Activity : Background : Tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) also known as B-cell-activating factor receptor (BAFFR) and CD268…
Name : Recombinant Human BAFF/BLyS/TNFSF13B Protein (ECD)Biological Activity : Background : B lymphocyte stimulator (BLyS), also known as TNFSF13B, CD257 and BAFF, is a single-pass type II membrane protein, which…
Name : Recombinant Human BAFF/BLyS/TNFSF13B ProteinBiological Activity : Background : B lymphocyte stimulator (BLyS), also known as TNFSF13B, CD257 and BAFF, is a single-pass type II membrane protein, which belongs…
Name : Recombinant Human BAFF/BLyS/TNFSF13B Protein (ECD, AVI & Fc Tag), BiotinylatedBiological Activity : Background : B lymphocyte stimulator (BLyS), also known as TNFSF13B, CD257 and BAFF, is a single-pass…
Name : Recombinant Betula pendula BETVIA ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Betula pendulaSource : E. coliTag : Protein Accession No. : P15494.2NCBI…
Name : Recombinant Human BAFF/BLyS/TNFSF13B Protein (hFc Tag)Biological Activity : Background : B lymphocyte stimulator (BLyS), also known as TNFSF13B, CD257 and BAFF, is a single-pass type II membrane protein,…
Name : Recombinant Human BACE1 ProteinBiological Activity : Background : Beta-site APP-cleaving enzyme 1 (BACE1) is an aspartic-acid protease important in the formation of myelin sheaths in peripheral nerve cells.…
Name : Recombinant Human BACE1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Beta-site APP-cleaving enzyme 1 (BACE1) is an aspartic-acid protease important in the formation of myelin sheaths in…
Name : Recombinant Human BACE1 Protein (hFc Tag)Biological Activity : Background : Beta-site APP-cleaving enzyme 1 (BACE1) is an aspartic-acid protease important in the formation of myelin sheaths in peripheral…
Name : Recombinant Human B7-H6/NCR3LG1 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No.…
Name : Recombinant Human B7-H6/NCR3LG1 Protein (His Tag)Biological Activity : Background : Biological Activity : 1.Measured by its binding ability in a functional ELISA. 2.Immobilized human B7-H6 -His(Cat:16140-H08H) at 10μg/mL…
Name : Recombinant Human B7-H6/NCR3LG1 Protein (hFc Tag)Biological Activity : Background : Biological Activity : 1.Measured by its binding ability in a functional ELISA. 2.Immobilized human NCR3(Cat:10480-H08H) at 10μg/mL (100μL/well)…
Name : Recombinant Human B7-H4 Protein (ECD, His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : V-set domain-containing T-cell activation inhibitor 1, also known as B7X, B7H4, B7S1, and…
Name : Recombinant Human B7-H4 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : V-set domain-containing T-cell activation inhibitor 1, also known as B7X, B7H4, B7S1, and VTCN1, is a…
Name : Recombinant Human B7-H4 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : V-set domain-containing T-cell activation inhibitor 1, also known as B7X, B7H4, B7S1, and VTCN1, is a…
Name : Recombinant Betula pendula Bet v 4 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : Betula pendulaSource : E. coliTag : Protein…
Name : Recombinant Human B7-H4 Protein (mFc Tag), HPLC-verifiedBiological Activity : Background : V-set domain-containing T-cell activation inhibitor 1, also known as B7X, B7H4, B7S1, and VTCN1, is a single-pass…
Name : Recombinant Human B7-H4 Protein (hFc Tag), Amine-Labeled BiotinylatedBiological Activity : Background : V-set domain-containing T-cell activation inhibitor 1, also known as B7X, B7H4, B7S1, and VTCN1, is a…
Name : Recombinant Human B7-H4 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : V-set domain-containing T-cell activation inhibitor 1, also known as B7X, B7H4, B7S1, and VTCN1, is a…
Name : Recombinant Human B7-H3 Protein (isoform 2, ECD, His Tag), HPLC-verifiedBiological Activity : Background : B7-H3 is a member of the B7 family of immune regulatory ligands that is…
Name : Recombinant Human B7-H3 Protein (isoform 2, hFc Tag), HPLC-verifiedBiological Activity : Background : B7-H3 is a member of the B7 family of immune regulatory ligands that is thought…
Name : Recombinant Human B7-H3 Protein (ECD, His & AVI Tag), BiotinylatedBiological Activity : Background : B7-H3 is a member of the B7 family of immune regulatory ligands that is…
Name : Recombinant Human B7-H3 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : B7-H3 is a member of the B7 family of immune regulatory ligands that is thought to…
Name : Recombinant Human B7-H3 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : B7-H3 is a member of the B7 family of immune regulatory ligands that is thought to…
Name : Recombinant Human B7-H3 Protein (ECD, hFc Tag), Amine-Labeled BiotinylatedBiological Activity : Background : B7-H3 is a member of the B7 family of immune regulatory ligands that is thought…
Name : Recombinant Human B7-H3 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : B7-H3 is a member of the B7 family of immune regulatory ligands that is thought to…
Name : Recombinant Aspergillus Fumigatus Asp f 15 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Aspergillus FumigatusSource : E. coliTag : Protein Accession No.…
Name : Recombinant Human B7-1/CD80 ProteinBiological Activity : Background : The B-lymphocyte activation antigen B7-1 (referred to as B7), also known as CD80, is a member of cell surface immunoglobulin…
Name : Recombinant Human B7-1/CD80 Protein (ECD, His & AVI Tag), HPLC-verified, BiotinylatedBiological Activity : Background : The B-lymphocyte activation antigen B7-1 (referred to as B7), also known as CD80,…
Name : Recombinant Human B7-1/CD80 Protein (hFc & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The B-lymphocyte activation antigen B7-1 (referred to as B7), also known as CD80, is…
Name : Recombinant Human B7-1/CD80 Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : The B-lymphocyte activation antigen B7-1 (referred to as B7), also known as CD80, is a member…
Name : Recombinant Human B7-1/CD80 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : The B-lymphocyte activation antigen B7-1 (referred to as B7), also known as CD80, is a member…
Name : Recombinant Human B4GALT1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Beta1,4-Galactosyltransferase-I (B4GALT1), one of seven beta1,4-galactosyltransferases, is an enzyme commonly found in the trans-Golgi complex that adds…
Name : Recombinant Human B3GNT6 Protein (aa 44-384, His Tag)Biological Activity : Background : B3GNT6 belongs to the glycosyltransferase 31 family. B3GNT6 play s an important role in the synthesis…
Name : Recombinant Human B3GNT2 Protein (hFc Tag)Biological Activity : Background : B3GNT2 belongs to the beta-1,3-N-acetylglucosaminyltransferase family. It is a type II transmembrane protein that prefers the substrate of…
Name : Recombinant Human B3GNT1 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_006867.1NCBI…
Name : Recombinant Human B3GAT3 Protein (His Tag)Biological Activity : Background : B3GAT3, encoding beta-1,3-glucuronyltransferase 3, has an important role in proteoglycan biosynthesis. Homozygous B3GAT3 mutations have been associated with…
Name : Recombinant Aspergillus Fumigatus Asp f 3 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Aspergillus FumigatusSource : E. coliTag : Protein Accession No.…
Name : Recombinant Human B3GALTL Protein (His Tag)Biological Activity : Background : B3GALTL is a beta-1,3-glucosyltransferase that transfers glucose to O-linked fucosylglycans on thrombospondin type-1 repeats (TSRs) of several proteins.…
Name : Recombinant Human B3GALT5 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No. : NP_006048.1NCBI…
Name : Recombinant Human B3GALT5 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : Q9Y2C3NCBI…
Name : Recombinant Human Beta-2 microglobulin Protein (His Tag), HPLC-verifiedBiological Activity : Background : B2M, also known as β2-Microglobulin or CDABP0092, is a component of MHC class I molecules found…
Name : Recombinant Human Azurocidin/CAP37 Protein (His Tag)Biological Activity : Background : Azurocidin (AZU1), also known as heparin-binding protein (HBP) or cationic antimicrobial protein 37 (CAP37), is an azurophil granule…
Name : Recombinant Human Zinc Alpha 2 Glycoprotein/AZGP1 Protein (His Tag)Biological Activity : Background : Alpha-2-glycoprotein, also known as AZGP1, belongs to the MHC class I family. It can be…
Name : Recombinant Human AXL Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Axl receptor tyrosine kinase, together with Tyro3 and Mer, constitute the TAM family of receptor tyrosine…
Name : Recombinant Human AXL Protein (ECD, mFc Tag), HPLC-verifiedBiological Activity : Background : Axl receptor tyrosine kinase, together with Tyro3 and Mer, constitute the TAM family of receptor tyrosine…
Name : Recombinant Human ATP6V1F Protein (GST Tag)Biological Activity : Background : ATP6V1F encodes a component of vacuolar ATPase mediating acidification. The cDNA and the genomic sequences of ATP6V1F were cloned successfully for…
Name : Recombinant Human ATP5D Protein (His Tag)Biological Activity : Background : ATP5D is a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient…
Name : Recombinant Aspergillus Fumigatus Asp f 28 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Aspergillus FumigatusSource : E. coliTag : Protein Accession No.…
Name : Recombinant Human ATP1B4 Protein (His Tag)Biological Activity : Background : ATP1B4 is a member of the X(+)/potassium ATPases subunit beta family. It is highly expressed in skeletal muscle…
Name : Recombinant Human ATP1B2 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_001669.3NCBI…
Name : Recombinant Human ATP1B1 Protein (His Tag)Biological Activity : Background : ATP1B1 belongs to the family of Na+/K+ and H+/K+-ATPases beta chain proteins, and to the subfamily of Na+/K+…
Name : Recombinant Human ATP citrate lyase/ACLY Protein (His Tag)Biological Activity : Background : ATP citrate lyase, also known as Acly or Acl, is the primary enzyme responsible for the…
Name : Recombinant Human ATOX1 Protein (His Tag)Biological Activity : Background : ATOX1 is a cytoplasmic copper chaperone that interacts with the copper-binding domain of the membrane copper transporters ATP7A…
Name : Recombinant Human ATL3 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : E. coliTag : Protein Accession No. : Q6DD88NCBI…
Name : Recombinant Human ATF2 Protein (His & GST Tag)Biological Activity : Background : Activating transcription factor 2, also known as ATF2, is a member of the leucine zipper family…
Name : Recombinant Human ASGR2 Protein (His Tag)Biological Activity : Background : ASGR2 is a subunit of the asialoglycoprotein receptor. Asialoglycoprotein receptor, also known as the Ashwell receptor, which is…
Name : Recombinant Human ASGR1 Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : The asialoglycoprotein receptor (ASGPR), an endocytotic cell surface receptor expressed by hepatocytes, is triggered…
Name : Recombinant Human ASGR1 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : The asialoglycoprotein receptor (ASGPR), an endocytotic cell surface receptor expressed by hepatocytes, is triggered by triantennary…
Name : Recombinant Aspergillus Fumigatus Asp f 24 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Aspergillus FumigatusSource : E. coliTag : Protein Accession No.…
Name : Recombinant Human ASGR1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The asialoglycoprotein receptor (ASGPR), an endocytotic cell surface receptor expressed by hepatocytes, is triggered by triantennary binding…
Name : Recombinant Human ASF1B Protein (His Tag)Biological Activity : Background : The histone chaperone anti-silencing factor 1a (ASF1a) interacts with MDC1 and is recruited to sites of DSBs to…
Name : Recombinant Human ASAM Protein (His Tag)Biological Activity : Background : Adipocyte-specific adhesion molecule (ASAM), also known as ACAM and CLMP, is a type I transmembrane protein and a…
Name : Recombinant Human ART3 Protein (His Tag)Biological Activity : Background : ART3 is an arginine-specific ADP-ribosyltransferase which belongs to the Arg-specific ADP-ribosyltransferase family. ART3 catalyzes a reversible reaction which…
Name : Recombinant Human ART1 Protein (His Tag)Biological Activity : Background : Mono-ADP-ribosyltransferase (ART) 1 belongs to a family of mammalian ectoenzymes that catalyze the transfer of ADP-ribose from NAD+…
Name : Recombinant Human ARSA Protein (His Tag)Biological Activity : Background : Arylsulfatase A (ARSA) is synthesized as a 52KDa lysosomal enzyme. It is a member of the sulfatase family…
Name : Recombinant Human Arp3/ACTR3 Protein (His & GST Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No.…
Name : Recombinant Human MANF Protein (hFc Tag)Biological Activity : Background : Mesencephalic astrocyte-derived neurotrophic factor, also known as Protein ARMET, Arginine-rich protein, MANF, and ARMET, is a secreted protein…
Name : Recombinant Human MANF Protein (His Tag)Biological Activity : Background : Mesencephalic astrocyte-derived neurotrophic factor, also known as Protein ARMET, Arginine-rich protein, MANF, and ARMET, is a secreted protein…
Name : Recombinant Human ARL6IP6 Protein (mFc Tag)Biological Activity : Background : It had been found that a homozygous truncating mutation in ARL6IP6 as the likely cause of a syndromic form of…
Name : Recombinant Aspergillus Fumigatus Asp f 22 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Aspergillus FumigatusSource : E. coliTag : Protein Accession No.…
Name : SARS-CoV-2 (2019-nCoV) Nucleocapsid-AVI & His recombinant Protein, BiotinylatedBiological Activity : Background : Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry.…
Name : Recombinant Human ARL2BP Protein (His Tag)Biological Activity : Background : ADP-ribosylation factor (ARF)-like proteins (ARLs) comprise a functionally distinct group of the ARF family of RAS-related GTPases. ARL2BP…
Name : Recombinant Human ARHI Protein (mFc Tag)Biological Activity : Background : ARHI, also known as DIRAS3, belongs to the small GTPase superfamily, Di-Ras family. ARHI gene is a novel…
Name : Recombinant Human Argonaute-2/AGO2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Argonaute 2 (AGO2), also known as Eukaryotic translation initiation factor 2C2 (EIF2C2), belongs to the Argonaute family,…
Name : Recombinant Human Argininosuccinate lyase Protein (His & GST Tag)Biological Activity : Background : The recycling of citrulline by argininosuccinate synthase 1 (ASS1) and argininosuccinate lyase (ASL) is crucial to maintain arginine availability…
Name : Recombinant Human Arginase 1/ARG1 Protein (His & MYC Tag)Biological Activity : Background : Arginase is the focal enzyme of the urea cycle hydrolysing L-arginine to urea and L-ornithine.…
Name : Recombinant Human Arginase 1/ARG1 Protein (His Tag)Biological Activity : Background : Arginase is the focal enzyme of the urea cycle hydrolysing L-arginine to urea and L-ornithine. Emerging studies…
Name : Recombinant Human ARF5 Protein (His Tag)Biological Activity : Background : ARF5, also known as ADP-ribosylation factor 5, belongs to the small GTPase superfamily, Arf family. Members of this…
Name : Recombinant Human ARF3 Protein (His Tag)Biological Activity : Background : ARF3, also known as ADP-ribosylation factor 3, belongs to the RAS superfamily. Members of this family include ARF1,…
Name : Recombinant Human ARF1 Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Invasion of tumor cells is a key step in metastasis that depends largely on…
Name : Recombinant Human ARF1 Protein (GST Tag)Biological Activity : Background : Invasion of tumor cells is a key step in metastasis that depends largely on the ability of these…
Name : Recombinant ASFV P72-C proteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : ASFVSource : E. coliTag : Protein Accession No. : NCBI Gene ID…
Name : Recombinant Human ARF1 Protein (His Tag)Biological Activity : Background : Invasion of tumor cells is a key step in metastasis that depends largely on the ability of these…
Name : Beta-amyloid 38 / Beta-APP38 Protein, Human, Recombinant (aa 672-709, His & GST Tag)Biological Activity : Background : Amyloid precursor protein (APP) is a type I transmembrane protein expressed…
Name : Beta-amyloid 39 / Beta-APP39 Protein, Human, Recombinant (aa 672-710, His & GST Tag)Biological Activity : Background : Amyloid precursor protein (APP) is a type I transmembrane protein expressed…
Name : Beta-amyloid 42 / Beta-APP42 Protein, Human, Recombinant (His & GST Tag)Biological Activity : Background : Amyloid precursor protein (APP) is a type I transmembrane protein expressed in many…
Name : Beta-amyloid 40 / Beta-APP40 Protein, Human, Recombinant (His & GST Tag)Biological Activity : Background : Amyloid precursor protein (APP) is a type I transmembrane protein expressed in many…
Name : Recombinant Human Beta-amyloid/Beta-APP Protein (hFc Tag)Biological Activity : Background : Amyloid precursor protein (APP) is a type I transmembrane protein expressed in many tissues and concentrated in the…
Name : Recombinant Human ApoM Protein (His Tag)Biological Activity : Background : ApoM (apolipoprotein M) is an apolipoprotein and member of the lipocalin protein family. The lipocalins share limited regions…
Name : Recombinant Human ApoM Protein (hFc Tag)Biological Activity : Background : ApoM (apolipoprotein M) is an apolipoprotein and member of the lipocalin protein family. The lipocalins share limited regions…
Name : Recombinant Human Apolipoprotein H Protein (His Tag), HPLC-verifiedBiological Activity : Background : Apolipoprotein H (APOH), also known as Beta-2-glycoprotein 1, Activated protein C-binding protein, B2GPI, and B2G1, is…
Name : Human Apolipoprotein E Protein (C130R, Isoform E4)Biological Activity : Background : Apolipoprotein E (ApoE) is a 34.2 kDa glycosylated protein with 299 amino acid residues. There are three…
Name : Recombinant ASFV P30Biological Activity : Background : Biological Activity : Testing in progressExpression Host : ASFVSource : Baculovirus-Insect CellsTag : Protein Accession No. : NCBI Gene ID :…
Name : Recombinant Human Apolipoprotein E/APOE Protein (isoform E3, His & Trx Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Apolipoprotein E (ApoE) is a 34.2 kDa glycosylated protein with 299…
Name : Recombinant Human Apolipoprotein E/APOE Protein (isoform E3, His & Trx Tag)Biological Activity : Background : Apolipoprotein E (ApoE) is a 34.2 kDa glycosylated protein with 299 amino acid…
Name : Recombinant Human Apolipoprotein A-I/APOA1 Protein (His Tag)Biological Activity : Background : Apolipoprotein A1 (APOA1) is a member of the apolipoprotein family whose members are proteins bind with lipids…
Name : Recombinant Human Apolipoprotein A-I/APOA1 Protein (hFc Tag)Biological Activity : Background : Apolipoprotein A1 (APOA1) is a member of the apolipoprotein family whose members are proteins bind with lipids…
Name : Recombinant Human APOL1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : APOL1, also known as apolipoprotein L1, is a minor apoprotein component of HDL (High-density lipoprotein) or 'good…
Name : Recombinant Human APOA4 Protein (His Tag)Biological Activity : Background : Apolipoprotein is genetically associated with the risk of Alzheimer's disease (AD). The APOA1, APOC3, and APOA4 genes are…
Name : Recombinant Human APOA1BP/AI-BP Protein (His Tag), HPLC-verifiedBiological Activity : Background : APOA1BP, now renamed NAXE, encodes an epimerase essential in the cellular metabolite repair for NADHX and NADPHX.…
Name : Recombinant Human APLP1 Protein (His Tag)Biological Activity : Background : APLP1, also known as amyloid-like protein 1, is a member of the highly conserved amyloid precursor protein gene…
Name : Recombinant Human APEG1 Protein (His Tag)Biological Activity : Background : Striated muscle preferentially expressed protein kinase, also known as aortic preferentially expressed protein 1, APEG-1, SPEG and KIAA1297,…
Name : Recombinant Human APE1/APEX1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding…
Name : Recombinant Artemisia vulgaris Art v 1 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : Artemisia vulgarisSource : HEK293 CellsTag : Protein…
Name : Recombinant Human APCDD1 Protein (hFc Tag)Biological Activity : Background : Osteosarcoma (OS) is the most common type of bone tumor in children and adults. The expression of APCDD1,…
Name : Recombinant Human AP2 Gamma/TFAP2C Protein (His Tag)Biological Activity : Background : TFAP2C, also known as AP2-GAMMA, is a member of the activating protein 2 family of transcription factors.…
Name : Recombinant Human ANTXR2 Protein (hFc Tag)Biological Activity : Background : Loss-of-function mutations in capillary morphogenesis gene 2 (CMG2/ANTXR2), a transmembrane surface protein, cause hyaline fibromatosis syndrome (HFS), a…
Name : Recombinant Human Antithrombin III Protein (His Tag)Biological Activity : Background : SerpinC1, also known as Antithrombin III (AT III), is a member of the serpin superfamily of serine…
Name : Recombinant Human ANP32A Protein (His & GST Tag)Biological Activity : Background : acidic leucine-rich nuclear phosphoprotein 32 family member A, also known as acidic nuclear phosphoprotein pp32, Leucine-rich…
Name : Recombinant Human Annexin VI/ANXA6 Protein (His Tag)Biological Activity : Background : Annexin A6, also known as ANXA6 or ANXAⅥ, belongs to a family of Ca2+-dependent membrane and phospholipid…
Name : Recombinant Human Annexin V/ANXA5 Protein, Amine-Labeled BiotinylatedBiological Activity : Background : The placental anticoagulant protein Annexin A5 (ANXA5) is a multifunctional protein that is highly expressed on the…
Name : Recombinant Human Annexin V/ANXA5 Protein, HPLC-verifiedBiological Activity : Background : The placental anticoagulant protein Annexin A5 (ANXA5) is a multifunctional protein that is highly expressed on the apical…
Name : Recombinant Human Annexin A8 Protein (His Tag)Biological Activity : Background : We have previously shown that Annexin A8 (ANXA8) is strongly associated with the basal-like subgroup of breast…
Name : Recombinant Human ANGPTL5 Protein (GST Tag)Biological Activity : Background : The angiopoietins are protein growth factors that promote angiogenesis, the formation of blood vessels from pre-existing blood vessels.…
Name : Recombinant Arachis hypogaea Ara h 9 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Arachis hypogaeaSource : P.pastorisTag : Protein Accession No. :…
Name : Recombinant Human ANGPTL4 Protein (His Tag)Biological Activity : Background : ANGPTL4, also known as ANGPTL2, is a protein with hypoxia-induced expression in endothelial cells. It contains 1 fibrinogen…
Name : Recombinant Human ANGPTL4 Protein (hFc Tag)Biological Activity : Background : ANGPTL4, also known as ANGPTL2, is a protein with hypoxia-induced expression in endothelial cells. It contains 1 fibrinogen…
Name : Recombinant Human ANGPTL3/Angiopoietin-like 3 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human ANGPTL3/Angiopoietin-like 3 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : Baculovirus-Insect CellsTag : Protein Accession No. :…
Name : Recombinant Human ANGPTL2 Protein (His Tag)Biological Activity : Background : The angiopoietin-like protein (ANGPTL) family is homologous to angiopoietins but does not bind to the Tie2 receptor. The…
Name : Recombinant Human Angiotensinogen Protein (His Tag), HPLC-verifiedBiological Activity : Background : Angiotensinogen, also known as AGT and SerpinA8, is a member of the serpin family. It is an…
Name : Recombinant Human Angiopoietin-4 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : NP_068769.2NCBI…
Name : Recombinant Human Angiopoietin-4 Protein (hFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. : Q9Y264NCBI…
Name : Recombinant Human Angiopoietin-2/ANGPT2 Protein (mFc Tag)Biological Activity : Background : Angiopoietin-2 (ANG 2, or ANGPT2), is a member of the ANG family, which plays an important role in…
Name : Recombinant Human Angiopoietin-2/ANGPT2 Protein (His & AVI Tag), Biotinylated, HPLC-verifiedBiological Activity : Background : Angiopoietin-2 (ANG 2, or ANGPT2), is a member of the ANG family, which plays…
Name : Recombinant Arachis hypogaea Ara h 9.0101 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Arachis hypogaeaSource : P.pastorisTag : Protein Accession No. :…
Name : Recombinant Human Angiopoietin-2/ANGPT2 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Angiopoietin-2 (ANG 2, or ANGPT2), is a member of the ANG family, which plays an important…
Name : Recombinant Human Angiopoietin-2/ANGPT2 Protein (His Tag)Biological Activity : Background : Angiopoietin-2 (ANG 2, or ANGPT2), is a member of the ANG family, which plays an important role in…
Name : Recombinant Human Angiopoietin-2/ANGPT2 Protein (His Tag)Biological Activity : Background : Angiopoietin-2 (ANG 2, or ANGPT2), is a member of the ANG family, which plays an important role in…
Name : Recombinant Human Angiopoietin-2/ANGPT2 Protein (His Tag)Biological Activity : Background : Angiopoietin-2 (ANG 2, or ANGPT2), is a member of the ANG family, which plays an important role in…
Name : Recombinant Human Angiopoietin-2/ANGPT2 Protein (hFc Tag)Biological Activity : Background : Angiopoietin-2 (ANG 2, or ANGPT2), is a member of the ANG family, which plays an important role in…
Name : Recombinant Human Angiopoietin-1/ANGPT1 Protein (hFc Tag)Biological Activity : Background : The angiopoietin (ANGPT)-TIE2/TEK signaling pathway is essential for blood and lymphatic vascular homeostasis. ANGPT1 is a potent TIE2…
Name : Recombinant Human AMPK (G1/B2/A2) Heterotrimer Protein (His & GST Tag)Biological Activity : Background : Biological Activity : The specific activity was determined to be 6 nmol/min/mg using synthetic…
Name : Recombinant Human AMPK (G1/B2/A1) Heterotrimer Protein (His & GST Tag)Biological Activity : Background : Biological Activity : The specific activity was determined to be 6 nmol/min/mg using synthetic…
Name : Recombinant Human AMPK (G1/B1/A2) Heterotrimer Protein (His & GST Tag)Biological Activity : Background : Biological Activity : The specific activity was determined to be 4 nmol/min/mg using synthetic…
Name : Recombinant Human AMPK (G1/B1/A1) Heterotrimer Protein (His & GST Tag)Biological Activity : Background : Biological Activity : The specific activity was determined to be 6 nmol/min/mg using synthetic…
Name : Recombinant Arachis hypogaea Ara h 6 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : Arachis hypogaeaSource : YeastTag : Protein Accession…
Name : Recombinant Human Aminopeptidase A Protein (His Tag)Biological Activity : Background : ENPEP, also known as aminopeptidase A, is a member of the peptidase M1 family. Members of this…
Name : Recombinant Human Aminoacylase 1 Protein (His Tag)Biological Activity : Background : Aminoacylase 1 (ACY1), a metalloenzyme that removes amide-linked ACY1 groups from amino acids and may play a…
Name : Recombinant Human AMIGO2 Protein (His Tag), Amine-Labeled BiotinylatedBiological Activity : Background : AMIGO2 contains Ig-like C2-type (immunoglobulin-like) domain, 6 LRR (leucine-rich) repeats, 1 LRRCT domain and 1 LRRNT…
Name : Recombinant Human AMIGO2 Protein (His Tag)Biological Activity : Background : AMIGO2 contains Ig-like C2-type (immunoglobulin-like) domain, 6 LRR (leucine-rich) repeats, 1 LRRCT domain and 1 LRRNT domain. It…
Name : Recombinant Human AMH Protein (His Tag)Biological Activity : Background : Anti-Mullerian hormone (AMH), a member of the TGF-beta superfamily, is produced by granulosa cells (GCs) of preantral and…
Name : Recombinant Human Amelotin Protein (mFc Tag)Biological Activity : Background : Amelotin (AMTN) is a tooth enamel protein which is expressed in maturation-stage ameloblasts and also in the internal…
Name : Recombinant Human ALR Protein (His Tag)Biological Activity : Background : Alterations in GFER gene have been associated with progressive mitochondrial myopathy, congenital cataracts, hearing loss, developmental delay, lactic…
Name : Recombinant Human ALR Protein (His Tag)Biological Activity : Background : Alterations in GFER gene have been associated with progressive mitochondrial myopathy, congenital cataracts, hearing loss, developmental delay, lactic…
Name : Recombinant Human ALPPL2/ALPG Protein (His Tag), HPLC-verifiedBiological Activity : Background : Alkaline Phosphatase, placental-like 2 (ALPPL2 or ALPG) is a (GPI)-anchored membrane protein and a member of the…
Name : Recombinant Human Alkaline Phosphatase/ALPL Protein (His Tag)Biological Activity : Background : Alkaline Phosphatase (ALPL) is a hydrolase enzyme responsible for removing phosphate groups from many types of molecules,…
Name : Recombinant Arachis hypogaea Ara h 3.01 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Arachis hypogaeaSource : E. coliTag : Protein Accession No.…
Name : Human alpha-Synuclein Protein (H50Q)Biological Activity : Background : Alpha-Synuclein (alpha-Syn), also known as NACP or SNCA, exists as at least two structural isoforms: one is helix-rich, membrane-bound form…
Name : Recombinant Human alpha-Synuclein ProteinBiological Activity : Background : Alpha-Synuclein (alpha-Syn), also known as NACP or SNCA, exists as at least two structural isoforms: one is helix-rich, membrane-bound form…
Name : Recombinant Human alpha-Synuclein Protein (His & AVI Tag), BiotinylatedBiological Activity : Background : Alpha-Synuclein (alpha-Syn), also known as NACP or SNCA, exists as at least two structural isoforms:…
Name : Recombinant Human alpha-Synuclein Protein (His Tag)Biological Activity : Background : Alpha-Synuclein (alpha-Syn), also known as NACP or SNCA, exists as at least two structural isoforms: one is helix-rich,…
Name : Recombinant Human Alpha SNAP Protein (His Tag)Biological Activity : Background : NAPA (NSF Attachment Protein Alpha) is a Protein Coding gene. This gene encodes a member of the…
Name : Recombinant Human alpha Lactalbumin/LALBA Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human alpha Lactalbumin/LALBA Protein (mFc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : HEK293 CellsTag : Protein Accession No. :…
Name : Recombinant Human Alpha-fetoprotein Protein (His Tag), HPLC-verifiedBiological Activity : Background : Alpha-fetoprotein (AFP) is classified as a member of the albuminoid gene superfamily consisting of albumin, AFP, vitamin…
Name : Recombinant Human Alpha-fetoprotein Protein (hFc Tag)Biological Activity : Background : Alpha-fetoprotein (AFP) is classified as a member of the albuminoid gene superfamily consisting of albumin, AFP, vitamin D…
Name : Recombinant Human alpha amylase/AMY2A Protein (His Tag), HPLC-verifiedBiological Activity : Background : Alpha-amylase is the major form of amylase found in humans and other mammals. Amylases are secreted…
Name : Recombinant Arachis hypogaea Ara h 3.01 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Arachis hypogaeaSource : E. coliTag : Protein Accession No.…
Name : Recombinant Human Allergin 1 Protein (His Tag)Biological Activity : Background : MILR1 (Mast Cell Immunoglobulin Like Receptor 1, also known as MCA32) is a Protein Coding gene. It…
Name : Recombinant Human Allergin 1 Protein (hFc Tag)Biological Activity : Background : MILR1 (Mast Cell Immunoglobulin Like Receptor 1, also known as MCA32) is a Protein Coding gene. It…
Name : Recombinant Human Alkaline phosphatase/APLI Protein (His Tag), HPLC-verifiedBiological Activity : Background : ALPI encodes for intestinal phosphatase alkaline, a brush border metalloenzyme that hydrolyses phosphate from the lipid…
Name : Recombinant Human Alkaline phosphatase/APLI Protein (hFc Tag)Biological Activity : Background : ALPI encodes for intestinal phosphatase alkaline, a brush border metalloenzyme that hydrolyses phosphate from the lipid A…
Name : Recombinant Human Alkaline Phosphatase/PLAP/ALPP Protein (His Tag)Biological Activity : Background : Most importantly, placental Alkaline Phosphatase (ALPP), an ectoenzyme that locates on cell surface with catalytic domains outside…
Name : Recombinant Human TGF-beta RI Protein (aa 200-503, His & GST Tag)Biological Activity : Background : Transforming growth factor, beta receptor I, also known as Transforming growth factor-beta receptor…
Name : Recombinant Human TGF-beta RI Protein (His & hFc Tag)Biological Activity : Background : Transforming growth factor, beta receptor I, also known as Transforming growth factor-beta receptor type I…
Name : Recombinant Human TGF-beta RI Protein (ECD, hFc Tag)Biological Activity : Background : Transforming growth factor, beta receptor I, also known as Transforming growth factor-beta receptor type I ,…
Name : Recombinant Human ALK4/ACVR1B Protein (His Tag)Biological Activity : Background : ALK-4 (Activin Receptor-Like Kinase 4) or ACVR1B (Activin A Receptor, type 1B), belongs to the protein kinase superfamily,…
Name : Recombinant Human ALK4/ACVR1B Protein (ECD, hFc Tag)Biological Activity : Background : ALK-4 (Activin Receptor-Like Kinase 4) or ACVR1B (Activin A Receptor, type 1B), belongs to the protein kinase…
Name : Recombinant Apple Mal d 1 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : AppleSource : P.pastorisTag : Protein Accession No. : NCBI Gene…
Name : Recombinant Human ALK-7 Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : ALK-7, also known as ALK7 and ACVR1C, belongs to the ALK family. It is a type…
Name : Recombinant Human ALK-1 Protein (His Tag)Biological Activity : Background : Activin A receptor, type II-like 1 (ACVRL1), also known as ALK-1 (activin receptor-like kinase 1), is an endothelial-specific…
Name : Recombinant Human ALK-1 Protein (hFc Tag)Biological Activity : Background : Activin A receptor, type II-like 1 (ACVRL1), also known as ALK-1 (activin receptor-like kinase 1), is an endothelial-specific…
Name : Recombinant Human Aldolase B Protein (GST Tag)Biological Activity : Background : The aldolase family members involved in metabolism and glycolysis are present in three isoforms: ALDOA, ALDOB, and ALDOC.…
Name : Recombinant Human ALDH7A1 Protein (His Tag)Biological Activity : Background : ALDH7A1 (Aldehyde dehydrogenase 7 family, member A1) is a member of subfamily 7 in the aldehyde dehydrogenase family.…
Name : Recombinant Human ALDH4A1 ProteinBiological Activity : Background : ALDH4A1 is a member of the aldehyde dehydrogenase family. Aldehyde dehydrogenase enzymes function in the metabolism of many molecules including…
Name : Recombinant Human ALDH4A1 Protein (His & GST Tag)Biological Activity : Background : ALDH4A1 is a member of the aldehyde dehydrogenase family. Aldehyde dehydrogenase enzymes function in the metabolism…
Name : Recombinant Human ALDH3A1 Protein (His Tag)Biological Activity : Background : Aldehyde dehydrogenase 3A1 (ALDH3A1) is a metabolic enzyme that catalyzes the oxidation of various aldehydes. Certain types of…
Name : Recombinant Human ALDH1A3 Protein (His Tag)Biological Activity : Background : Aldehyde dehydrogenase 1 family, member A3 (ALDH1A3), also known as Retinaldehyde dehydrogenase 3 (RALDH3), which belongs to the…
Name : Recombinant Human ALDH1A1 Protein (His Tag)Biological Activity : Background : Aldehyde dehydrogenase 1 family, member A1 (ALDH1A1), also known as Aldehyde dehydrogenase 1 (ALDH1), or Retinaldehyde Dehydrogenase 1…
Name : Recombinant Amaranthus retroflexus Ama r 2 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Amaranthus retroflexusSource : E. coliTag : Protein Accession No.…
Name : SARS-CoV-2 (2019-nCoV) Nucleocapsid-His recombinant ProteinBiological Activity : Background : Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry. Coronavirus nucleoproteins localize…
Name : Recombinant Human AKT3 Protein (GST Tag)Biological Activity : Background : v-akt murine thymoma viral oncogene homolog 3 (AKT3), also known as PKB-GAMMA, with AKT1/PKBalpha, AKT2/PKBbeta, are the memerbers…
Name : Recombinant Human AKT2 Protein (His & GST Tag)Biological Activity : Background : AKT (AK mouse plus Transforming or Thymoma) is a frequent oncogene expressed in most tissues which…
Name : Recombinant Human AKT1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : v-akt murine thymoma viral oncogene homolog 1 (AKT1), or protein kinase B-alpha (PKB-ALPHA) is a serine-threonine protein…
Name : Recombinant Human AKR1C4 Protein (His Tag)Biological Activity : Background : Aldo-keto reductases comprise of AKR1C1-AKR1C4, four enzymes that catalyze NADPH dependent reductions and have been implicated in biosynthesis,…
Name : Recombinant Human AKR1C2 Protein (His Tag)Biological Activity : Background : AKR1C2 is a member of the aldo/keto reductase superfamily, which consists of more than 4 known enzymes and…
Name : Recombinant Human AKR1B1 Protein (His Tag)Biological Activity : Background : Aldose reductase (AKR1B1) belongs to the aldo/keto reductase superfamily. AKR1B1 is a NADPH-dependent aldo-keto reductase best known as…
Name : Recombinant Human AKR1A1 Protein (His Tag)Biological Activity : Background : Aldehyde reductase (AKR1A1) is a member of the aldo-keto reductase superfamily, which consists of more than 40 known…
Name : Recombinant Human AK3L1 ProteinBiological Activity : Background : Adenylate kinase isoenzyme 4, mitochondrial, also known as ATP-AMP transphosphorylase, Adenylate kinase 3-like, AK4 and AK3L1, is a member theadenylate…
Name : Recombinant Human AK3L1 Protein (His & GST Tag)Biological Activity : Background : Adenylate kinase isoenzyme 4, mitochondrial, also known as ATP-AMP transphosphorylase, Adenylate kinase 3-like, AK4 and AK3L1,…
Name : Recombinant Human AIM2 Protein (GST Tag)Biological Activity : Background : AIM2, Absent In Melanoma 2 is a member of the interferon-inducible HIN-200 protein family that contains an amino-terminal…
Name : Recombinant Alternaria alternate Alt a 1 Protein, HPLC-verifiedBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Alternaria alternateSource : E. coliTag : Protein Accession…
Name : Recombinant Human AHSP ProteinBiological Activity : Background : AHSP, also known as ERAF, is a conserved mammalian erythroid protein which belongs to the AHSP family. It is expressed…
Name : Recombinant Human AGRP Protein (His Tag)Biological Activity : Background : Agouti Related Protein (AGRP, or AGRT), is an endogenous antagonist of the melanocortin receptors MC3R and MC4R found…
Name : Recombinant Human AGRP Protein (hFc Tag)Biological Activity : Background : Agouti Related Protein (AGRP, or AGRT), is an endogenous antagonist of the melanocortin receptors MC3R and MC4R found…
Name : Recombinant Human AGRP Protein (hFc Tag)Biological Activity : Background : Agouti Related Protein (AGRP, or AGRT), is an endogenous antagonist of the melanocortin receptors MC3R and MC4R found…
Name : Recombinant Human AGR3 Protein (mFc Tag)Biological Activity : Background : Anterior gradient protein (AGR) 3 is a highly related homologue of pro-oncogenic AGR2 and belongs to the family…
Name : Recombinant Human AGO3 Protein (His Tag)Biological Activity : Background : Argonaute (Ago) protein family plays a key role in the RNA interference (RNAi) process in different insects including…
Name : Recombinant Human AGO1 Protein (His Tag)Biological Activity : Background : Protein argonaute-1, also known as eukaryotic translation initiation factor 2C 1, EIF2C1, and AGO1, is a member of…
Name : Recombinant Human Aspartylglucosaminidase/AGA Protein (His Tag)Biological Activity : Background : AGA (Aspartylglucosaminidase) is an amidohydrolase enzyme involved in the catabolism of N-linked oligosaccharides of glycoproteins. This gene encodes…
Name : Recombinant Human AFM Protein (His Tag)Biological Activity : Background : Afamin is an 87 kDa glycoprotein with five predicted N-glycosylation sites. Afamin's glycan abundance contributes to conformational and…
Name : Recombinant Human Adrenomedullin Protein (hFc Tag)Biological Activity : Background : Adrenomedullin consists of 52 amino acids and is a member of the Adrenomedullin family. It s a a…
Name : Recombinant Aequorea victoria GFP Protein (His Tag)Biological Activity : Background : The green fluorescent protein (GFP) is a protein that exhibit bright green fluorescence when exposed to blue…
Name : Recombinant Human ADPRH Protein (His Tag)Biological Activity : Background : Cholera toxin (CT) produced by Vibrio cholerae causes the devastating diarrhea of cholera by catalyzing the ADP-ribosylation of…
Name : Recombinant Human ADK Protein (His & GST Tag)Biological Activity : Background : Adenosine kinase(ADK) belongs to the family of transferases. Adenosine kinase (ADK) is the key enzyme in…
Name : Recombinant Human Adiponectin Protein (His Tag)Biological Activity : Background : Adiponectin (ADIPOQ), or 30 kDa adipocyte complement-related protein (Acrp30) is a protein secreted by adipose tissue, which acts…
Name : Recombinant Human Adiponectin Protein (hFc Tag)Biological Activity : Background : Adiponectin (ADIPOQ), or 30 kDa adipocyte complement-related protein (Acrp30) is a protein secreted by adipose tissue, which acts…
Name : Recombinant Human Adenylosuccinate Lyase Protein (His Tag)Biological Activity : Background : Adenylosuccinate lyase, also known as adenylosuccinase, ADSL or ASL, is an enzyme implicated in the reaction of…
Name : Recombinant Human Adenylate Kinase 1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The adenylate kinase (AK) isoforms network plays an important role in the intracellular energy transfer…
Name : Recombinant Human Adenosine Deaminase Protein (His Tag), HPLC-verifiedBiological Activity : Background : Adenosine Desaminase (ADA) deficiency, is a purine metabolic disorder that cause severe combined immunodeficiency (SCID) due…
Name : Recombinant Human ADAMTSL1 Protein (His Tag)Biological Activity : Background : ADAMTSL1 is a secreted molecule resembling members of the ADAMTS protein family of matrix metalloproteinases. Both ADAMTS proteins…
Name : Recombinant Human ADAM8/CD156a Protein (ECD, His Tag)Biological Activity : Background : ADAM8, also known as CD156, is a member of the ADAM (a disintegrin and metalloprotease domain) family.…
Name : Recombinant Human ADAM15 Protein (His Tag)Biological Activity : Background : ADAM15, also known as Metargidin, is a type I transmembrane glycoprotein belonging to the ADAM (A Disintegrin and…
Name : Recombinant Aequorea victoria GFP Protein (His Tag), HPLC-verifiedBiological Activity : Background : The green fluorescent protein (GFP) is a protein that exhibit bright green fluorescence when exposed to…
Name : Recombinant Human ADAM15 Protein (His Tag)Biological Activity : Background : ADAM15, also known as Metargidin, is a type I transmembrane glycoprotein belonging to the ADAM (A Disintegrin and…
Name : Recombinant Human ADAM12 Protein (His Tag)Biological Activity : Background : The ADAMs (a disintegrin and metalloprotease) comprise a family of multidomain proteins with metalloprotease, cell adhesion, and signaling…
Name : Recombinant Human ACYP2 Protein (GST Tag)Biological Activity : Background : Recent genome-wide association studies have identified genetic variants in ACYP2 and WFS1 that are associated with cisplatin-induced ototoxicity. We sought to explore…
Name : Recombinant Human ACYP1 Protein (GST Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HumanSource : E. coliTag : Protein Accession No. : P07311NCBI…
Name : Recombinant Human ACVR2B Protein (His Tag)Biological Activity : Background : ACVR2A and ACVR2B are two activin type II receptors. ACVR2B is integral to the Activin And myostatin signaling…
Name : Recombinant Human ACVR2B Protein (ECD, hFc Tag), HPLC-verifiedBiological Activity : Background : ACVR2A and ACVR2B are two activin type II receptors. ACVR2B is integral to the Activin And…
Name : Recombinant Human ACVR2A Protein (His Tag), HPLC-verifiedBiological Activity : Background : ACVR2A and ACVR2B are two activin type II receptors. ACVR2A has been shown to interact with INHBA,…
Name : Recombinant Human ACVR2A Protein (hFc Tag)Biological Activity : Background : ACVR2A and ACVR2B are two activin type II receptors. ACVR2A has been shown to interact with INHBA, SYNJ2BP…
Name : Recombinant Human ACVR1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : ALK-2, also termed as ACVR1, was initially identified as an activin type I receptor because of its…
Name : Recombinant Human ACVR1 Protein (His & hFc Tag)Biological Activity : Background : ALK-2, also termed as ACVR1, was initially identified as an activin type I receptor because of…
Name : Recombinant Actinidia deliciosa Act d 8 ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : Actinidia deliciosaSource : P.pastorisTag : Protein Accession No. :…
Name : Recombinant Human, Mouse, Rat, Cynomolgus, Rhesus Activin A Protein, HPLC-verifiedBiological Activity : Background : Activin And inhibin are two closely related protein complexes that have almost directly opposite…
Name : Recombinant Human Prostatic Acid Phosphatase/ACPP Protein (His Tag), HPLC-verifiedBiological Activity : Background : Prostatic Acid Phosphatase (PAP, or ACPP), also known as prostatic specific Acid Phosphatase (PSAP), is…
Name : Recombinant Human ACPL2 Protein (His Tag)Biological Activity : Background : acid phosphatase-like protein 2, also known as ACPL2, is a secreted protein which belongs to thehistidine acid phosphatase…
Name : Recombinant Human ACP5 Protein (His Tag)Biological Activity : Background : Tartrate-resistant acid phosphatase (TRACP) or acid phosphatase 5, tartrate resistant (ACP5 or TRAP) is a glycosylated monomeric metalloenzyme…
Name : Recombinant Human ACOX1 Protein (His Tag)Biological Activity : Background : Peroxisomal acyl-coenzyme A oxidase 1(ACOX1 or AOX) is the first enzyme of the fatty acid beta-oxidation pathway and…
Name : Recombinant Human ACOT13/THEM2 Protein (His Tag)Biological Activity : Background : The metabolites of fatty acyl-Coenzyme A (CoA) and metabolic enzymes contribute to lipid biosynthesis, signal transduction, and gene…
Name : Recombinant Human Aconitase 2 Protein (His & GST Tag)Biological Activity : Background : A homozygous missense mutation was identified in the ACO2 gene (c.1240T>G p.Phe414Val) that segregated with HSP complicated…
Name : Recombinant Human Aconitase 1/ACO1 Protein (His Tag)Biological Activity : Background : Aconitase 1(ACO1) or IRP1 is one member of the aconitase family that contains a diverse group of…
Name : Recombinant Human ACK1 Protein (GST Tag)Biological Activity : Background : ACK1 (also known as ACK, TNK2, or activated Cdc42 kinase) is a structurally unique non-receptor tyrosine kinase that…
Name : Recombinant Human Acid Phosphatase/ACP1 Protein (GST Tag)Biological Activity : Background : The low molecular weight phosphotyrosine phosphatase (LMW-PTP), also known as Acid Phosphatase 1 (ACP1), belongs to the…
Name : AcmNPV Envelope glycoprotein gp64 / AcmNPV-gp64 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : AcMNPVSource : HEK293 CellsTag : Protein Accession…
Name : Recombinant Human ACE2 Protein (His & AVI Tag), BiotinylatedBiological Activity : Background : Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS)…
Name : Recombinant Human ACE2 Protein (His Tag), Amine-Labeled Biotinylated, HPLC-verifiedBiological Activity : Background : Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS)…
Name : Recombinant Human ACE2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS) by counterbalancing…
Name : Recombinant Human ACE2 Protein (His Tag), HPLC-verifiedBiological Activity : Background : Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS) by counterbalancing…
Name : Recombinant Human ACE2 Protein (mFc Tag)Biological Activity : Background : Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS) by counterbalancing ACE…
Name : Recombinant Human ACE2 Protein (hFc Tag), Amine-Labeled BiotinylatedBiological Activity : Background : Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS) by…
Name : Recombinant Human ACE2 Protein (hFc Tag)Biological Activity : Background : Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS) by counterbalancing ACE…
Name : Recombinant Human ABP1/AOC1 Protein (His Tag)Biological Activity : Background : Amine oxidase copper-containing 1 (AOC1; formerly known as amiloride-binding protein 1) is a secreted glycoprotein that catalyzes the…
Name : Recombinant Human GPA33/A33 Protein (His Tag)Biological Activity : Background : Cell surface A33 antigen, also known as glycoprotein A33, is a single-pass type I membrane protein that is…
Name : Recombinant Human 5T4/TPBG Protein (ECD, His Tag), HPLC-verifiedBiological Activity : Background : Trophoblast glycoprotein (TPBG), also known as 5T4, is the therapeutic target of several anticancer agents currently…
Name : AcmNPV Envelope glycoprotein gp64 / AcmNPV-gp64 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : AcMNPVSource : Baculovirus-Insect CellsTag : Protein Accession…
Name : Recombinant Human 5T4/TPBG Protein (His Tag), HPLC-verifiedBiological Activity : Background : Trophoblast glycoprotein (TPBG), also known as 5T4, is the therapeutic target of several anticancer agents currently in…
Name : Recombinant Human 4EBP1 Protein (His Tag), HPLC-verifiedBiological Activity : Background : The translational suppressor eIF4E binding protein-1, 4E-BP1 functions as a key regulator in cellular growth, differentiation, apoptosis…
Name : Recombinant Human 4-1BB Ligand/TNFSF9 Protein (AVI & Fc Tag), BiotinylatedBiological Activity : Background : 4-1BB ligand is the high affinity ligand of 4-1BB, also known as CD137L or…
Name : Recombinant Human 4-1BB Ligand/TNFSF9 Protein (ECD, hFc Tag)Biological Activity : Background : 4-1BB ligand is the high affinity ligand of 4-1BB, also known as CD137L or TNFSF9. It…
Name : Recombinant Human 2B4/CD244 Protein (ECD, His & AVI Tag), BiotinylatedBiological Activity : Background : The CD244 antigen, also known as 2B4, is a cell surface glycoprotein implicated in…
Name : Recombinant Human 2B4/CD244 Protein (hFc & AVI Tag), BiotinylatedBiological Activity : Background : The CD244 antigen, also known as 2B4, is a cell surface glycoprotein implicated in the…
Name : Recombinant Human 2B4/CD244 Protein (His Tag)Biological Activity : Background : The CD244 antigen, also known as 2B4, is a cell surface glycoprotein implicated in the regulation of natural…
Name : Recombinant Human 2B4/CD244 Protein (hFc Tag)Biological Activity : Background : The CD244 antigen, also known as 2B4, is a cell surface glycoprotein implicated in the regulation of natural…
Name : Recombinant Human 15-PGDH Protein (His Tag)Biological Activity : Background : 15-hydroxyprostaglandin dehydrogenase , also known as Prostaglandin dehydrogenase 1, HPGD, and PGDH1, is a member of the short-chain…
Name : Recombinant Human 15 Lipoxygenase 2 ProteinBiological Activity : Background : ALOX15B is a member of the lipoxygenase family of structurally related nonheme iron dioxygenases involved in the production…
Name : SARS-CoV-2 (2019-nCoV) Plpro/papain-like protease-His recombinant protein (aa 1564-1880)Biological Activity : Background : The coronaviral proteases, papain-like protease (PLpro) and 3C-like protease (3CLpro), are attractive antiviral drug targets because…
Name : Recombinant Human 15 Lipoxygenase 2 Protein (His & GST Tag)Biological Activity : Background : ALOX15B is a member of the lipoxygenase family of structurally related nonheme iron dioxygenases…
Name : Recombinant Human 14‑3‑3/YWHAQ Protein (GST Tag)Biological Activity : Background : The recently identified 14-3-3 tau, whose corresponding gene name is YWHAQ, is in a hypoxia-treated human trophoblast cell…
Name : Recombinant Human 14-3-3 sigma ProteinBiological Activity : Background : 14-3-3 protein sigma (YWHAS), also known as stratifin (SFN) and epithelial cell marker protein 1, is a member of…
Name : Recombinant Human 14-3-3 sigma Protein (GST Tag)Biological Activity : Background : 14-3-3 protein sigma (YWHAS), also known as stratifin (SFN) and epithelial cell marker protein 1, is a…
Name : Recombinant Human 14-3-3 eta/YWHAH Protein (GST Tag)Biological Activity : Background : YWHAH, the gene encoding the 14-3-3eta isoform, is highly expressed in retinal ganglion cells (RGC). YWHAH is…
Name : Recombinant Human 14-3-3 epsilon ProteinBiological Activity : Background : YWHAE, also known as 14-3-3 epsilon, mediate signal transduction by binding to phosphoserine-containing proteins. 14-3-3 epsilon / YWHAE is…
Name : Recombinant Human 14-3-3 epsilon Protein (GST Tag)Biological Activity : Background : YWHAE, also known as 14-3-3 epsilon, mediate signal transduction by binding to phosphoserine-containing proteins. 14-3-3 epsilon /…
Name : Recombinant Human 14-3-3 beta ProteinBiological Activity : Background : 14-3-3 beta / YWHAB is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group of highly…
Name : Recombinant Human 14-3-3 beta Protein (GST Tag)Biological Activity : Background : 14-3-3 beta / YWHAB is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group…
Name : Hantaan virus HTNV (strain 84FLi) Nucleocapsid / NP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HTNVSource : Baculovirus-Insect CellsTag :…
Name : SARS-CoV-2 (2019-nCoV) Nucleocapsid-His recombinant Protein, BiotinylatedBiological Activity : Background : Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry. Coronavirus nucleoproteins…
Name : Recombinant HSV-2 gG-CEBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HSV2Source : E. coliTag : Protein Accession No. : NCBI Gene ID :…
Name : HSV 2 (strain HG52) gE/glycoprotein E Protein (ECD, His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HSV2Source : Baculovirus-Insect CellsTag : Protein…
Name : HSV 2 (strain 333) gD Protein (ECD, His Tag)Biological Activity : Background : Biological Activity : Immobilized Recombinant Human CD111 / Nectin-1 / PVRL1 Protein (Fc Tag) (Cat:11611-H02H)…
Name : HSV 2 (strain 333) gD Protein (ECD, His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HSV2Source : Baculovirus-Insect CellsTag : Protein Accession…
Name : HSV 2 (strain 333) gC Protein (ECD, His Tag)(HPLC-verified)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HSV2Source : HEK293 CellsTag : Protein Accession…
Name : HSV 2 (strain 333) gC Protein (ECD, His Tag)(HPLC-verified)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HSV2Source : Baculovirus-Insect CellsTag : Protein Accession…
Name : HSV 2 (strain 333) Glycoprotein B Protein (His Tag)Biological Activity : Background : Cytomegalovirus (CMV) (human herpesvirus 5) glycoprotein B, also referred as CMV gB or gB, which…
Name : Recombinant HSV-1 gG-CEBiological Activity : Background : Biological Activity : Testing in progressExpression Host : HSV1Source : E. coliTag : Protein Accession No. : NCBI Gene ID :…
Name : Recombinant HSV-1 gD N1Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HSV1Source : P.pastorisTag : Protein Accession No. : NCBI Gene ID :…
Name : HPV18 E7 Protein (His Tag)(HPLC-verified)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HPVSource : E. coliTag : Protein Accession No. : P06788NCBI Gene…
Name : SARS-CoV-2 (2019-nCoV) NSP8-AVI Recombinant ProteinBiological Activity : Background : NSP8 is a nonstructural protein of coronavirus. NSP8 acts as a primase in RNA synthesis. NSP8 and NSP7 are…
Name : HPV18 E6 Protein (N-His-MBP & C-AVI Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HPVSource : E. coliTag : Protein Accession No. :…
Name : HPV16 E7 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HPVSource : E. coliTag : Protein Accession No. : P03129NCBI Gene…
Name : HPV16 E6 Protein (His Tag)(HPLC-verified)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HPVSource : E. coliTag : Protein Accession No. : P03126NCBI Gene…
Name : Human Papilloma Virus type 6 (HPV 6) L1 protein (VLP)Biological Activity : Background : Papillomaviruses are highly species-specific and can cause squamous epithelial and fibroepithelial tumors in their…
Name : Human Papilloma Virus type 59 (HPV 59) L1 protein (VLP)Biological Activity : Background : Papillomaviruses are highly species-specific and can cause squamous epithelial and fibroepithelial tumors in their…
Name : Human Papilloma Virus type 58 (HPV 58) L1 protein (VLP)Biological Activity : Background : Papillomaviruses are highly species-specific and can cause squamous epithelial and fibroepithelial tumors in their…
Name : Human Papilloma Virus type 56 (HPV 56) L1 protein (VLP)Biological Activity : Background : Papillomaviruses are highly species-specific and can cause squamous epithelial and fibroepithelial tumors in their…
Name : Human Papilloma Virus type 52 (HPV 52) L1 protein (VLP)Biological Activity : Background : Papillomaviruses are highly species-specific and can cause squamous epithelial and fibroepithelial tumors in their…
Name : Human Papilloma Virus type 45 (HPV 45) L1 protein (VLP)Biological Activity : Background : Papillomaviruses are highly species-specific and can cause squamous epithelial and fibroepithelial tumors in their…
Name : Human Papilloma Virus type 39 (HPV 39) L1 protein (VLP)Biological Activity : Background : Papillomaviruses are highly species-specific and can cause squamous epithelial and fibroepithelial tumors in their…
Name : SARS-CoV-2 (2019-nCoV) NSP7-Recombinant ProteinBiological Activity : Background : NSP7 is conserved within the coronaviridae. NSP7 is a component of the coronavirus replicase polyprotein to comprise a repilication complex.…
Name : SARS-CoV-2 (2019-nCoV) Nucleocapsid(D3L, S235F)-His Recombinant ProteinBiological Activity : Background : Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry. Coronavirus nucleoproteins…
Name : Human Papilloma Virus type 35 (HPV 35) L1 protein (VLP)Biological Activity : Background : Papillomaviruses are highly species-specific and can cause squamous epithelial and fibroepithelial tumors in their…
Name : Human Papilloma Virus type 33 (HPV 33) L1 protein (VLP)Biological Activity : Background : Papillomaviruses are highly species-specific and can cause squamous epithelial and fibroepithelial tumors in their…
Name : Human Papilloma Virus type 31 (HPV 31) L1 protein (VLP)Biological Activity : Background : Papillomaviruses are highly species-specific and can cause squamous epithelial and fibroepithelial tumors in their…
Name : Human Papilloma Virus type 18 (HPV 18) L1 protein (VLP)Biological Activity : Background : Papillomaviruses are highly species-specific and can cause squamous epithelial and fibroepithelial tumors in their…
Name : Human Papilloma Virus type 16 (HPV 16) L1 protein (VLP)Biological Activity : Background : Papillomaviruses are highly species-specific and can cause squamous epithelial and fibroepithelial tumors in their…
Name : Human Papilloma Virus type 11 (HPV 11) L1 protein (VLP)Biological Activity : Background : Papillomaviruses are highly species-specific and can cause squamous epithelial and fibroepithelial tumors in their…
Name : Human parainfluenza virus 4b (HPIV-4b) Hemagglutinin-neuraminidase Protein (aa 48-579, His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HPIV-4Source : Baculovirus-Insect CellsTag :…
Name : Human parainfluenza 3 virus (HPIV-3) (strain Wash/47885/57) Hemagglutinin-neuraminidase Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HPIV-3Source : Baculovirus-Insect CellsTag :…
Name : Human metapneumovirus (strain HMPV/Homo sapiens/PER/CFI0466/2010/B) glycoprotein G Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HMPVSource : HEK293 CellsTag : Protein…
Name : Human metapneumovirus (strain HMPV/Homo sapiens/PER/CFI0320/2010/A) glycoprotein G Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HMPVSource : HEK293 CellsTag : Protein…
Name : SARS-CoV-2 (2019-nCoV) Methyltransferase / ME-his Recombinant ProteinBiological Activity : Background : Coronavirus encodes the 2’-O-MTase (2'O Methyltransferase) that is composed of the catalytic subunit nsp16 and the stimulatory…
Name : HIV-p66 / RT-p66 (group M, subtype B (isolate HXB2) Gag-Pol polyprotein Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HIVSource :…
Name : HIV-p51 / RT-p51 (group M, subtype B (isolate HXB2) Gag-Pol polyprotein Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HIVSource :…
Name : HIV-2 gp36 Protein (subtype CRF01_AB, strain 07JP_NMC716_clone_01) (His & MBP Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HIVSource : E. coliTag :…
Name : HIV-1 gp140 Protein (group P, strain RBF168) (Fc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HIVSource : HEK293 CellsTag : Protein Accession…
Name : Human immunodeficiency virus 1 (HIV-1) (group M, subtype C, strain 92BR025) gp140 Protein (Fc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HIVSource…
Name : HIV-1 gp140 Protein (group M, subtype A, strain 92UG037.1) (Fc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HIVSource : HEK293 CellsTag :…
Name : HIV-1 gp140 Protein (group M, subtype CRF07_BC) (His Tag)Biological Activity : Background : Biological Activity : 1.Immobilized Recombinant HIV-1 gp140 Protein (group M, subtype CRF07_BC) (His Tag) (Cat:…
Name : HIV-1 gp140 Protein (group M, subtype CRF07_BC) (Fc Tag)Biological Activity : Background : Biological Activity : Using the Octet RED System, the affinity constant (Kd) of gp140-Fc bound…
Name : Human immunodeficiency virus HIV gp120 Protein (His & AVI Tag), BiotinylatedBiological Activity : Background : The HIV-1 gp120 envelope protein, a glycoprotein that is part of the outer…
Name : Human immunodeficiency virus 1 (HIV-1) (group M, subtype B, Isolate MN) gp120 Protein (His Tag)Biological Activity : Background : The HIV-1 gp120 envelope protein, a glycoprotein that is…
Name : SARS-CoV-2 (2019-nCoV) Helicase-His Recombinant ProteinBiological Activity : Background : Biological Activity : Testing in progressExpression Host : SARS-CoV-2Source : E. coliTag : Protein Accession No. : YP_009725308.1NCBI Gene…
Name : HIV-1 (group M, subtype B, isolate BAL) gp120 Protein (His Tag)Biological Activity : Background : The HIV-1 gp120 envelope protein, a glycoprotein that is part of the outer…
Name : HIV-1 (group M, subtype A, isolate 92RW020) Envelope glycoprotein gp160 Protein (gp120 subunit) (His Tag)Biological Activity : Background : The HIV-1 gp120 envelope protein, a glycoprotein that is…
Name : HIV-1 (group M, subtype B, strain SHIV-89.6P) gp120 Protein (His Tag)Biological Activity : Background : The HIV-1 gp120 envelope protein, a glycoprotein that is part of the outer…
Name : HIV-1 gp120 Protein (group P, strain RBF168) (His Tag)Biological Activity : Background : The HIV-1 gp120 envelope protein, a glycoprotein that is part of the outer layer of…
Name : HIV-1 gp160 Protein (gp120 subunit) (group N, strain 06CM-U14296) (His Tag)Biological Activity : Background : The HIV-1 gp120 envelope protein, a glycoprotein that is part of the outer…
Name : HIV-1 gp120 (group M, subtype CRF07_BC) Protein (His Tag), BiotinylatedBiological Activity : Background : The HIV-1 gp120 envelope protein, a glycoprotein that is part of the outer layer…
Name : HIV-1 gp120 Protein (group M, subtype CRF07_BC) (His Tag)Biological Activity : Background : The HIV-1 gp120 envelope protein, a glycoprotein that is part of the outer layer of…
Name : HIV-1 p24 Protein (group O, strain BCF06) (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HIVSource : E. coliTag : Protein Accession…
Name : HIV-1 p24 protein (group N, strain 06CM-U14296) (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HIVSource : E. coliTag : Protein Accession…
Name : HIV-1 p24 Protein (group M, subtype D, strain NDK) (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HIVSource : E. coliTag :…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : HIV-1 p24 Protein (group M, subtype C, strain 92BR025) (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HIVSource : E. coliTag :…
Name : HIV-1 p24 Protein (group M, subtype B, strain HXB2) (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HIVSource : E. coliTag :…
Name : HIV-1 p24 Protein (group M, subtype B, strain 92418) (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HIVSource : E. coliTag :…
Name : Hendra virus (HeV) (isolate Horse/Autralia/Hendra/1994) Glycoprotein Protein (Fc Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HeVSource : HEK293 CellsTag : Protein Accession…
Name : Hepatitis C virus (HCV-1a) NS3 protease / helicase immunodominant region Protein (aa 1356-1459, GST Tag)Biological Activity : Background : HCV NS3 displays three enzymatic activities: serine protease, NTPase,…
Name : Hepatitis C virus (HCV) (serotype 1c,isolate HC-G9) E2 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HCVSource : HEK293 CellsTag :…
Name : Hepatitis C virus (HCV) (serotype 1b, isolate HC-J4) Envelope / E2 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HCVSource :…
Name : Hepatitis C virus (HCV-1a) E2 Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HCVSource : HEK293 CellsTag : Protein Accession No.…
Name : Hepatitis C virus Envelope Glycoprotein E1 / HCV-E1 (subtype 1b, strain HC-J4) Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HCVSource…
Name : Human coronavirus (HCoV-OC43) Hemagglutinin esterase Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HCoV-OC43Source : HEK293 CellsTag : Protein Accession No.…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD-rFc Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Human coronavirus (HCoV-OC43) Spike S1 Protein (His Tag)Biological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on…
Name : Human coronavirus (HCoV-OC43) Spike S2 Protein (ECD, His Tag)Biological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors…
Name : Human coronavirus (HCoV-OC43) Spike S1+S2 Protein (ECD, His Tag), BiotinylatedBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain…
Name : Human coronavirus (HCoV-OC43) Spike Protein (S1+S2 ECD, His Tag)Biological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors…
Name : Human coronavirus (HCoV-OC43) Nucleocapsid Protein (His Tag)Biological Activity : Background : Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry. Coronavirus…
Name : Human coronavirus (HCoV-NL63) Spike S1+S2 Protein (ECD, His Tag), BiotinylatedBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain…
Name : Human coronavirus (HCoV-NL63) Spike Protein (S1+S2 ECD, His Tag)Biological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors…
Name : Human coronavirus (HCoV-NL63) Spike/S1 Protein (S1 Subunit, His Tag)Biological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors…
Name : Human coronavirus (HCoV-NL63) Nucleocapsid Protein (His Tag)Biological Activity : Background : Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry. Coronavirus…
Name : Human coronavirus HKU1 (isolate N5) (HCoV-HKU1) Spike S1+S2 Protein (ECD, His Tag), BiotinylatedBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD-AVI & His Recombinant Protein, Biotinylated (HPLC-verified)Biological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain…
Name : Human coronavirus HKU1 (isolate N5) (HCoV-HKU1) Spike Protein (S1+S2 ECD, His Tag)Biological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind…
Name : Human coronavirus HKU1 (isolate N5) (HCoV-HKU1) Spike/S1 Protein (S1 Subunit, His Tag)Biological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind…
Name : Human coronavirus HKU1 (isolate N1) (HCoV-HKU1) Spike/S1 Protein (S1 Subunit, His Tag)Biological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind…
Name : Human coronavirus HKU1 (isolate N1) (HCoV-HKU1) Spike S2 Protein (His Tag)Biological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to…
Name : Human coronavirus (HCoV-HKU1) Nucleocapsid Protein (His Tag)Biological Activity : Background : Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry. Coronavirus…
Name : Human coronavirus (HCoV-229E) Spike S1+S2 Protein (ECD, His Tag), BiotinylatedBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain…
Name : Human coronavirus (HCoV-229E) Spike Protein (S1+S2 ECD, His Tag)Biological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors…
Name : Human coronavirus (HCoV-229E) Spike/S1 Protein (S1 Subunit, His Tag)Biological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors…
Name : Human coronavirus (HCoV-229E) Nucleocapsid Protein (His Tag)Biological Activity : Background : Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry. Coronavirus…
A-39) and reverse (59-AGAGCACGAACACAGAGA-39); mouse NPT2a, forward (59-CTTCAACATCCGAGGTGG-39) and reverse (59-ATCCGAATGAGACTGTGA-39); mouse NPT2c, forward (59-GCCATTGTCTACCTACTATTAACC-39) and reverse (59-ACATTAACCAGGATGATAAGGAG-39); and mouse b-actin, forward (59-TTTCCAGCCTTCCTTCTTGGGTATG39) and reverse (59-CACTGTGTTGGCATAGAGGTCTTTAC39).***P,0.001 were thought of very…
Ated by gross pharmacological glutamatergic stimulation (18, 21). Such observations could be significantly improved by using TimeSTAMP (72) to image nascent MMP-9 with greater spatiotemporal resolution (72) in acute slices…
+ ions, although this has small impact on the protein conformation. As in the C2 structure, there's clearly defined electron density linking the side chains of Thr-11 and Gln-141 (Fig.…
Name : Hepatitis B Virus (HBV)(ayw/France/Tiollais/1979) Capsid protein (His Tag)Biological Activity : Background : Hepatitis B virus (HBV) capsid assembly is a critical step in the propagation of the virus…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD-AVI & His Recombinant Protein, BiotinylatedBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors…
Name : Recombinant Hamster FUT8 Protein (aa 68-575, His Tag)Biological Activity : Background : Alpha (1,6) fucosyltransferase 8, also known as FUT8, is a member of the glycosyltransferase family. Fucosyltransferases…
Name : Recombinant Hamster FGF-21 Protein (His Tag)Biological Activity : Background : Fibroblast growth factor 21 (FGF21) is a member of the fibroblast growth factor (FGF) family. FGF family members…
Name : Human mastadenovirus E (HAdV-E) fiber Recombinant (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HAdV-ESource : Baculovirus-Insect CellsTag : Protein Accession No.…
Name : Human mastadenovirus B (HAdV-B) encapsidation protein IVa2 Recombinant (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : HAdV-BSource : Baculovirus-Insect CellsTag : Protein…
Name : Influenza A H9N8 (A/chicken/Korea/164/04) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H9N5 (A/shorebird/DE/261/2003) Hemagglutinin /HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket on…
Name : Influenza A H9N5 (A/shorebird/DE/261/2003) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H9N2 (A/Hong Kong/1073/99) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a…
Vizzani SC, Robbins PD: Gene therapy for established murine collagen induced arthritis by local and systemic adenovirus-mediated delivery of interleukin-4. Arthritis Res 2000, two:293-302. 30. Apparailly F, Verwaerde C, Jacquet…
Py (reinduction) with their assigned remedy regimen if they had illness progression. The original primary end point was the very best all round response price (i.e., the proportion of individuals…
Therapy alone (Fig. 5C and 5G) or HeICS alone (Fig. 5D and 5H). Cellular regulation of VHS in response to DSS and HeICS To determine potential targets for pharmacological interventions,…
Name : Influenza A H9N2 Neuraminidase / NA (Active)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase…
Name : Influenza A H9N2 (A/chicken/Hong Kong/G9/1997) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD-His (W436R) Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the…
Name : Influenza A H9N2 (A/Hong Kong/3239/2008) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H9N2 (A/Hong Kong/3239/2008) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H9N2 (A/Hong Kong/35820/2009) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H9N2 (A/Hong Kong/35820/2009) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H9N2 (A/chicken/Hong Kong/G9/1997) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H9N2 (A/chicken/Hong Kong/G9/1997) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H9N2 (A/duck/Hong Kong/448/78) Hemagglutinin Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket on…
Ers from substantial item inhibition (KI 1 M) . Subsequent rational design and style of esterases showed that very simple peptides are also capable of catalyzing this reaction, albeit no…
Of Biotechnology and Environmental Chemistry, Kitami Institute of Technology, Kitami, Hokkaido 090507, Japan S. Kanda : T. Nishiyama Division of Public Well being, Kansai Healthcare University, Moriguchi, Osaka 570506, JapanJ…
Vels in the occipital gray matter had been identified to be drastically distinct amongst controls and T1DM sufferers with typical illness duration of 222 years. Other metabolites did not show…
Name : Influenza A H9N2 (A/duck/Hong Kong/448/78) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(K417N, E484K, N501Y)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on…
Name : Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H9N2 (A/Hong Kong/1073/99) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H9N2 (A/Hong Kong/1073/99) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H9N1 (A/duck/NZL/76/1984) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H9N1 (A/duck/NZL/76/1984) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Linicians with an added cost-effective treatment option for spinal metastases which has far better short-term benefits and comparable long-term outcomes to EBRT.analysis resultsSPINESRS, stereotactic radiosurgery; SBRT, stereotactic body radiation therapy;…
Ook development is defective in Arabidopsis mutant echidna (ech). ECH protein is required for the trans-Golgi network (TGN) ediated trafficking from the auxin influx carrier AUX1 towards the plasma membrane.…
Teins just isn't obligatory, the chromatin hub is usually regarded as to be a folded chromatin domain or even a nuclear compartment, exactly where regulatory elements as well as the…
S conducted under field situations which includes wholesome volunteers , at the same time as children who are at high threat of VL , indicated that the vaccine containing alum-precipitated…
Set A B AGR2 A B REG1B PDAC versus wholesome controls LOXL2 A B A B CA19.9 A B Median healthy 3.82 three.56 184.85 117.40 4364.00 4582.00 139.45 106.8 six.00…
Name : Influenza A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H8N4 (A/pintail duck/Alberta/114/1979) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H7N9 (A/Shanghai/2/2013) Nucleoprotein / NP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : H7N9Source : Baculovirus-Insect CellsTag : Protein…
Name : Influenza A H7N9 (A/Anhui/1-BALF_RG6/2013) Nucleoprotein / NP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : H7N9Source : Baculovirus-Insect CellsTag : Protein…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(E484K)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H7N9 (A/Shanghai/1/2013) Neuraminidase / NA (Active)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of…
Name : Influenza A H7N9 (A/Shanghai/1/2013) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : Influenza A H7N9 (A/Anhui/1/2013) Neuraminidase / NA (Active)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of…
Name : Influenza A H7N9 (A/Anhui/1/2013) Neuraminidase / NA (His Tag), BiotinylatedBiological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a…
Name : Influenza A H7N9 (A/Anhui/1/2013) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Chemistry examination which includes Scr was performed for 1 year after kidney transplantation (KT). 99mTc DTPA clearance was performed at about six months from KT, as a part of the…
Thogenfree housing conditions. To activate the transactivating function in the rtTA protein, mice were fed with rodent chow containing 200 mg/kg Dox (Dox diet program, Bio-Serv). Animal research and care…
On evaluation of effects of an insoluble, fungi-derived (1-3)(1-6)-D-glucan as dietary supplement in piglets. We measured the development, phagocytosis of peripheral blood cells and interleukin 2 (IL-2) and tumor necrosis…
Cells were recovered by peritoneal lavage applying 5 mL of ice-cold sterile phosphate-buffered saline (PBS) plus 0.1 EDTA (ethylenediaminetetraacetic acid). Spleens were dissociated into single cell suspensions by mechanical disruption…
Of the all round cellular EPA and DHA contents, respectively (Figure 5B,D). EPA has been previously shown to be concentrated particularly in monogalactosylacylglycerols (MGDG) and TAG in P. lutheri; conversely,…
Ors. Following these findings, we performed a further click chemistry method, looking for to find HDAC3-selective inhibitors extra potent and selective than compounds 1 and 2. We describe here the…
Name : Influenza A H7N9 (A/Anhui/1/2013) Matrix protein 1 / M1 Protein (His Tag)Biological Activity : Background : The Influenza virus matrix protein 1 (M1) is a matrix protein of…
Name : Influenza A H7N9 (A/Zhejiang/DTID-ZJU10/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N9 (A/Zhejiang/DTID-ZJU10/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N9 (A/Shanghai/2/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N9 (A/Shanghai/2/2013) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(F490L)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : SARS-CoV-2 (2019-nCoV) Nucleocapsid(D3L, R203K, G204R, S235F)-His Recombinant ProteinBiological Activity : Background : Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry.…
Name : Influenza A H7N9 (A/Shanghai/4664T/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N9 (A/Zhejiang/1/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N9 (A/Hangzhou/3/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Contractility response to methacholine, serum levels of IL-4 and IFN-c or the IL-4-to-IFN-c ratio between the S+G2F and S+G2 groups. The preventive effects in the studied adjuvants on enhanced tracheal…
L cord (Figure two). In fact, alpha2 adrenergic receptors have a peripheral analgesic impact, thanks to the activation of opioidergic receptors, through endogenous opioid release12. Furthermore, both alpha1 and alpha2…
Ncet 2009, 374(9694):PubMed PMID: 19726078 ubMed PMID: 19726997. PubMed PMID: 19726078. 19. Rassen JA, Choudhry NK, Avorn J, Schneeweiss S: Cardiovascular outcomes and mortality in sufferers working with clopidogrel with…
Er `clustered' or `not clustered'. Quantitative evaluation of co-clustering was performed by systematically screening for clustered myotubes inside the red channel (very same criteria described for the triad targeting) and…
Ents (342 and 200 when the clinician scorer was regarded as to become the gold typical). The typical quantity of apnoea epochs for the patient group throughout the evening was…
Ommercial antibodies used within the present paper are anti-ACC (acetyl-CoA carboxylase) (Cell Signaling Technologies, catalogue number 3662), anti-(ACC p-Ser79 )HEK (human embryonic kidney)-293 and U2OS cells were cultured in DMEM…
Name : Influenza A H7N9 (A/Pigeon/Shanghai/S1069/2013) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N9 (A/Pigeon/Shanghai/S1069/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N9 (A/Pigeon/Shanghai/S1069/2013) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N9 (A/Pigeon/Shanghai/S1069/2013) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H7N9 (A/Hangzhou/1/2013) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N9 (A/Hangzhou/1/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N9 (A/Hangzhou/1/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(N501Y)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H7N9 (A/Shanghai/1/2013) Hemagglutinin / HA Protein (HA1+HA2, cleavage) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H7N9 (A/Shanghai/1/2013) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Atio 0.82, p five .038). Patients who received GE had toxicities like rashes, diarrhea, infection, and stomatitis. The presence of rash was linked having a larger illness handle rate (p…
Hen DH, Sun L. Effects on the stilbene extracts from Cajanus cajan L. on ovariectomy-induced bone loss in rats. Yao Xue Xue Bao 2007;42:562-5. 23. Siddhuraju P. Antioxidant activity of…
His mechanism in human enterocytes. A earlier study reported that infected Caco-2 cells sustain redox balance throughout RV infection . The authors concluded that cell destruction caused by RV was…
Plementary MaterialRefer to Internet version on PubMed Central for supplementary material.AcknowledgmentsWe thank Harrison Gabel for assistance and components, and Martha Koerner, Thomas Clouaire and Sabine Lagger for comments on the…
I et al., 2013). Each "bulk" and "rim only" batches of powdered shells integrated the medium and fine fractions only (i.e. 50e500 mm particle size).Sub-fossil P. vulgata information used for…
001**Statistically substantial. Tested by Fisher's exact test and chi-square test; TKI, tyrosine kinase inhibitor; PBC, platinum-based chemotherapy; NPBC, non-platinum primarily based chemotherapy. Table five. Response to resumed TKIs Response PR…
Name : Influenza A H7N9 (A/Shanghai/1/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N9 (A/Shanghai/1/2013) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N9 (A/Shanghai/1/2013) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA Protein (HA1+HA2, cleavage) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N8 (A/mallard/Netherlands/33/2006) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(E484Q)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H7N8 (A/mallard/Netherlands/33/2006) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Had been washed with PBS and digested in 275 mL of 1.0 N acetic acid overnight at 4 . For calcium quantification, an orthocresolphthalein complex 1 (OCPC) process was employed…
PAverage F control, 1 week ( ) 11.1 0.5 65.eight four.2 ten.three 1.7 10.3 1.five 9.9 2.4 7.six 0.1 6.7 1.0 9.3 89.6 7.two 1.0 77.4 2.9 20.7 8.1 eight.6…
Mol. Sci. 2013,were increased. In addition, it should be noted that the lysine contents in T2 transgenic lines have been increased to a significantly higher extent than in T1 generation,…
Precise ST2 expression in CD11b GR1int cells and in CD19 cells compared together with the isotype control antibody (Fig. 2B). Certainly, the imply fluorescent intensity (MFI) ratios of the anti-ST2…
He cells nevertheless keep away from the EphB1-Fc containing stripes. (L) Addition of ephrin-B3 siRNA does not influence MGE-derived neurons developing on Fc/control stripes. (M) Quantification (imply SEM) from the…
Tag Web page was absent (Fig. 1C, a red asterisk), suggesting that Ser65 will be the genuine Parkin phosphorylation web-site in mouse major neurons. The presence of a much less…
Name : Influenza A H7N7 (A/Netherlands/219/2003) Neuraminidase / NA (Active)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of…
Name : Influenza A H7N7 (A/Netherlands/219/2003) Neuraminidase / NA Protein (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a…
Name : Influenza A H7N7 (A/equine/Kentucky/1a/1975) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N7 (A/chicken/Netherlands/1/03) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N7 (A/chicken/Netherlands/1/03) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N7 (A/Netherlands/219/2003) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N7 (A/Netherlands/219/2003) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N3 (A/chicken/SK/HR-00011/2007) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N3 (A/turkey/Italy/214845/2002) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(Y453F)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
E BCAA-supplemented wort, possibly from increased expression of genes encoding amino acid permeases (e.g. BAP2 and BAP3) as a result of improved amino acid concentrations (Didion et al. 1996). Supplementation…
Ially) spike firing. An illustration from the occasion detection routine utilized for this objective is offered inside the electronic supplementary material (On line Resource 1). The size of events identified…
Eremothecium gossypii ATCC 10895 (= Ashbya gossypii ATCC 10895) , Aspergillus fumigatus Af293 , Bacillus cereus 03BB102, Debaryomyces hansenii var hansenii CBS767 , Escherichia coli 55989 , Homo sapiens ,…
Malised to GAPDH mRNA expression. The relative fold modify was calculated relative to LPS and data presented as imply six SEM. *P,0.05 vs. LPS (one-way ANOVA). (B,C) The incubation medium…
As shown that obesity increases cerebrocortical ROS and impairs brain function . Diabetes can also be a substantial threat issue for dementia generally, which includes AD, and likely vascular dementia…
O pursue the identificationwww.impactjournals/oncotargetof possible agents that could restore BRM, and working with higher throughput screening using a functional BRM assay, we located many unique compounds capable of restoring BRM…
Name : Influenza A H7N3 (A/turkey/Italy/214845/2002) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H7N2 (A/ruddy turnstone/New Jersey/563/2006) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H7N2 (A/ruddy turnstone/New Jersey/563/2006) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H7N1 (A/turkey/Italy/4602/99) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H6N8 (A/mallard/Ohio/217/1998) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H6N8 (A/mallard/Ohio/217/1998) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H6N6 (A/duck/Eastern China/11/2009) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H6N5 (A/shearwater/Australia/1/1973) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H6N4 (A/chicken/Hong Kong/17/1977) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H6N4 (A/chicken/Hong Kong/17/1977) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
He PEPCK1 precursor was decreased strikingly only within the 35S:MC9 extract, without the need of the appearance of discrete proteolytic fragments (Figure 5C), possibly mainly because cleavagefragments at the COFRADIC-identified…
Resident macrophages 28 h right after infection. (C) Resident macrophages had been infected with L. big and cultured for 48 h. Supernatants were assayed for lyzozyme activity. As a handle,…
Also demonstrated that resveratrol prevented cardiomyocyte hypertrophy by restoring the impaired AMPK activity in phenylephrine exposed cardiomyocytes at the same time as in SHR rats (Chan et al., 2008; Dolinsky…
Nately, the P2X3Rresponsivity could not be measured promptly immediately after S3 due to desensitization. Therefore, this protocol can be employed only for slowly dissociating antagonists that stick towards the receptor…
Activities than ZYJ-34c and SAHA against all tested tumor cell lines. Meanwhile, it was notable that ZYJ-34c epimer and ZYJ-34c possessed lower toxicity to normal human lung fibroblast cell line…
GeneAmp PCR technique 2720 (Applied Biosystems; Foster City) . Primers for Bcl-2 have been 5-CTGGCATCTTCTCCT TCCAG-3 and 5-GACGGTAGCGGACGAG-AGAAG3; Bax were 5-TTTGCTTCAGGGTTTCATCC-3 and 5-CAGTTGAAGTTGCCGTCAGA-3; and GAPDH (internal typical) were 5-CAGAACATCATCCCTGCC TCT-3…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(G476S)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H6N4 (A/chicken/Hong Kong/17/1977) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H6N2 (A/chicken/Guangdong/C273/2011) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H6N2 (A/chicken/Guangdong/C273/2011) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H6N2 (A/duck/Shantou/83/2000) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H6N2 (A/duck/Shantou/83/2000) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H6N1 (A/quail/Hong Kong/1721-30/99) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H6N1 (A/northern shoveler/California/HKWF115/2007) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H6N1 (A/northern shoveler/California/HKWF115/2007) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N9 (A/chicken/Italy/22A/1998) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Be formed (29). The 1:2:three G-quadruplex demands G12 and G13 within the core G-tetrads and can be isolated making use of the Pu22-T15T16 sequence (Supplementary Figure S4A). Despite the fact…
Erg et al., 2008). The enrichment of marine anammox bacteria was obtained in an anoxic sequencing batch bioreactor (SBR), fed with water containing sea salt and the substrates ammonium, nitrite…
Uminum hydroxide (Sigma, St. Louis, MO) diluted with normal saline to a total volume of 200 . On days 21 to 23, they had been anesthetized intraperitoneally with 1 pentobarbital…
S; 44 of HCC samples that we evaluated harbored TERT promoter mutations (27/61). This locating tends to make TERT by far the most commonly mutated gene however observed within this…
Uire no infrastructure, minimal reagents, no coaching, and no electricity . Peptide-based diagnostics may possibly be developed into a lateral flow assay , and so MDPs may perhaps be useful…
Nchymal precursor cells (MPCs). These cells are a subset of the heterogeneous bone marrow-derived mesenchymal stem cell populationPLOS A single | www.plosone.orgthat are chosen primarily based on the expression in…
Name : Influenza A H5N9 (A/chicken/Italy/22A/1998) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(V445F)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H5N8 (A/Astrakhan/3212/2020) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N8 (A/Astrakhan/3212/2020) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N8 (A/turkey/California/K1500169-1.2/2015) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N8 (A/turkey/Germany-MV/R2472/2014 ) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N8 (A/turkey/Germany-MV/R2472/2014) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N8 (A/Ch/Netherlands/14015526/2014) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N8 (A/Ch/Netherlands/14015526/2014) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N8 (A/duck/Zhejiang/6D18/2013) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N8 (A/duck/Zhejiang/W24/2013) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N8 (A/duck/Jiangsu/k1203/2010) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(P499R)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H5N8 (A/broiler duck/Korea/Buan2/2014) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N8 (A/broiler duck/Korea/Buan2/2014) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N8 (A/broiler duck/Korea/Buan2/2014) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N8 (A/turkey/Ireland/1378/1983) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N8 (A/turkey/Ireland/1378/1983) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N8 (A/duck/NY/191255-59/2002) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N8 (A/duck/NY/191255-59/2002) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(G446S)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H5N6 (A/yunnan/0127/2015) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N6 (A/Sichuan/26221/2014) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N6 (A/Sichuan/26221/2014) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N6 (A/duck/Jiangxi/95/2014) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N6 (A/duck/Jiangxi/95/2014) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N6 (A/duck/Guangdong/GD01/2014) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Cells have been cultured for 24 hours inside the presence of mouse IL-15 (50 ng/ml) prior to using them as a tumor therapeutic. Preparation of stimulatory lipid-coated silica microspheres Preparation…
Azepines, amphetamines, ecstasy (3,4-methylenedioxymethamphetamine ), cocaine, phencyclidine (PCP), and marijuana (tetrahydrocannabinol ). If qualitative UDT final results were optimistic, the suitable quantitative confirmatory testing was performed employing gas chromatography, high-pressure…
On of the TGI-induced protein oxidation, activated caspase-3 expression and DNA fragmentation in hippocampal proteins. Exogenous application of pioglitazone, a PPAR agonist, lowered the p-Drp1(Ser616) expression, decreased TGI-induced oxidative pressure…
Name : Influenza A H5N6 (A/duck/Guangdong/GD01/2014) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N3 (A/duck/Hokkaido/167/2007) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N3 (A/duck/Hokkaido/167/2007) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N2 (A/chicken/Iowa/04-20/2015) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(N487R)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H5N2 (A/chicken/Iowa/04-20/2015) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N2 (A/ostrich/South Africa/AI1091/2006) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N2 (A/American green-winged teal/California/HKWF609/2007) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H5N2 (A/American green-winged teal/California/HKWF609/2007) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H5N1 (A/Cambodia/NPH230032/2023) Nucleoprotein / NP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : H5N1Source : Baculovirus-Insect CellsTag : Protein…
Name : Influenza A H5N1 (A/Thailand/1(KAN-1)/2004) Neuraminidase / NA Protein (His Tag), BiotinylatedBiological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is…
Name : Influenza A H5N1 (A/Thailand/1(KAN-1)/2004) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Neuraminidase / NA (Active)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of…
Name : Influenza A H5N1 (A/Hubei/1/2010) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : Influenza A H5N1 Neuraminidase / NA (H255Y) (Active)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(F486S)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H5N1 (A/Anhui/1/2005) Neuraminidase / NA (Active)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of…
Name : Influenza A H5N1 (A/Anhui/1/2005) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : Influenza A H5N1 (A/Cambodia/NPH230032/2023) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/chicken/Ghana/AVL-763_21VIR7050-39/2021) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/chicken/VietNam/NCVD-016/2008) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Probable make an critical contribution to SP resistance. Within this examine, we tend not to possess the data to the HIV prevalence or positivity of your review populations and we…
Verse events have been additional frequent with chemotherapy, even though treatment-related deaths had been more frequent amongst individuals handled with gefitinib.47 There was no efficacy advantage in a further trial23;…
Linical element and SNP combined model utilizing C-statistics or AUC. All statistical testing used SPSS Statistics, v17.0 (SPSS Inc., Chicago, IL) and R v.three.1.0 application packages. Statistical significance was defined…
Name : Influenza A H5N1 (A/Egypt/N0001/2015) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Cambodia/X0123311/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Bangladesh/207095/2008) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Egypt/1394-NAMRU3/2007) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/China/2006) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(F456E)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : SARS-CoV-2 (2019-nCoV) Nucleocapsid(I292T)-His Recombinant ProteinBiological Activity : Background : Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry. Coronavirus nucleoproteins localize…
Name : Influenza A H5N1 (A/Hong Kong/378.1/2001) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/chicken/Jilin/9/2004) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/chicken/Jilin/9/2004) Hemagglutinin Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket on the…
Name : Influenza A H5N1 (A/chicken/Jilin/9/2004) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/barn swallow/Hong Kong/D10-1161/2010) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H5N1 (A/barnswallow/HongKong/D10-1161/2010) Hemagglutinin Protein (HA1+HA2) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket on…
Name : Influenza A H5N1 (A/barnswallow/HongKong/D10-1161/2010) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/chicken/VietNam/NCVD-016/2008) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/chicken/VietNam/NCVD-016/2008) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/chicken/VietNam/NCVD-016/2008) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(Y505C)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H5N1 (A/bar-headed goose/Qinghai/1A/2005) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/bar-headed goose/Qinghai/1A/2005) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/chicken/Yamaguchi/7/2004) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/chicken/Yamaguchi/7/2004) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Thailand/1(KAN-1)/2004) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Hubei/1/2010) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Egypt/3300-NAMRU3/2008) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/common magpie/Hong Kong/5052/2007) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H5N1 (A/common magpie/Hong Kong/5052/2007) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H5N1 (A/common magpie/Hong Kong/5052/2007) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(F456L)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H5N1 (A/Cambodia/S1211394/2008) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Cambodia/S1211394/2008) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/goose/Guangdong/1/1996) Hemagglutinin Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket on the…
Name : Influenza A H5N1 (A/goose/Guangdong/1/1996) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Vietnam/UT31413II/2008) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Vietnam/UT31413II/2008) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Hubei/1/2010) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/hubei/1/2010) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(N481D)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/Hong kong/213/2003) Hemagglutinin Protein (HA1 Subunit) (28 Ser/Trp, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a…
Name : Influenza A H5N1 (A/Hong kong/213/2003) Hemagglutinin / HA Protein (28 Ser/Trp, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a…
Name : Influenza A H5N1 (A/Hong kong/213/2003) Hemagglutinin / HA (S28W) Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/chicken/India/NIV33487/06) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/chicken/India/NIV33487/06) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/chicken/India/NIV33487/06) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Cambodia/R0405050/2007) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Cambodia/R0405050/2007) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD-His (K458R) Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the…
Name : Influenza A H5N1 (A/Cambodia/R0405050/2007) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/whooper swan/Mongolia/244/2005) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/whooper swan/Mongolia/244/2005) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/duck/Laos/3295/2006) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H5N1 (A/duck/Hunan/795/2002) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/duck/Hunan/795/2002) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(K458Q)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin Protein (HA1 Subunit) (His Tag), BiotinylatedBiological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a…
Name : Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin / HA Protein (His Tag), BiotinylatedBiological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a…
Name : Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/goose/Guiyang/337/2006) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Hong Kong/483/1997) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/Hong Kong/483/1997) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(L455F)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Vietnam/1194/2004) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/Vietnam/1194/2004) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Vietnam/1194/2004) Hemagglutinin / HA Protein (His Tag), BiotinylatedBiological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/Vietnam/1194/2004) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/turkey/Turkey/1/2005) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/turkey/Turkey/1/2005) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/turkey/Turkey/1/2005) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Indonesia/5/2005) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Indonesia/5/2005) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(S477R)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H5N1 (A/Indonesia/5/2005) Hemagglutinin / HA-specific B cell probe (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H5N1 (A/Indonesia/5/2005) Hemagglutinin / HA (R339G, S341R) Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/bar-headed goose/Qinghai/14/2008) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/bar-headed goose/Qinghai/14/2008) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/bar-headed goose/Qinghai/14/2008) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H5N1 (A/Anhui/1/2005) Hemagglutinin Protein (HA1 Subunit)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket on the…
Name : Influenza A H5N1 (A/Anhui/1/2005) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Anhui/1/2005) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Anhui/1/2005) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Anhui/1/2005) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H5N1 (A/Anhui/1/2005) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(P521R)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H5N1 (A/Anhui/1/2005) Hemagglutinin / HA Protein (His & Fc Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H5N1 (A/VietNam/1203/2004) Hemagglutinin / HA Protein (His & Fc Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H5N1 (A/VietNam/1203/2004) Hemagglutinin Protein (HA1 Subunit) (His & Fc Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H4N6 (A/mallard/Ohio/657/2002) Neuraminidase / NA (Active)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of…
Name : Influenza A H4N6 (A/mallard/Ohio/657/2002) Neuraminidase / NA Protein (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a…
Name : Influenza A H4N6 (A/mallard/Ohio/657/2002) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H4N6 (A/mallard/Ohio/657/2002) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H4N6 (A/Swine/Ontario/01911-1/99) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(P337S)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H4N6 (A/Swine/Ontario/01911-1/99) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H4N4 (A/mallard duck/Alberta/299/1977) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H4N4 (A/mallard duck/Alberta/299/1977) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H4N4 (A/mallard duck/Alberta/299/1977) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H4N2 (A/duck/Hunan/8-19/2009) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N8 (A/equine/Gansu/7/2008) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N8 (A/equine/Gansu/7/2008) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Panama/2007/99) Nucleoprotein / NP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : H3N2Source : Baculovirus-Insect CellsTag : Protein…
Name : Influenza A H3N2 (A/Massachusetts/18/2022)/(A/Darwin/9/2021)/(A/Darwin/6/2021) Nucleoprotein / NP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : H3N2Source : Baculovirus-Insect CellsTag : Protein…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD-His (F342L) Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the…
Name : SARS-CoV-2 (2019-nCoV) Nucleocapsid(S194L)-His Recombinant ProteinBiological Activity : Background : Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry. Coronavirus nucleoproteins localize…
Name : Influenza A H3N2 (A/Hong Kong/4801/2014) Nucleoprotein / NP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : H3N2Source : Baculovirus-Insect CellsTag :…
Name : Influenza A H3N2 (A/Kansas/14/2017) / (A/Singapore/INFIMH-16-0019/2016) Nucleoprotein / NP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : H3N2Source : Baculovirus-Insect CellsTag…
Name : Influenza A H3N2 (A/Cambodia/e0826360/2020) Nucleoprotein / NP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : H3N2Source : Baculovirus-Insect CellsTag : Protein…
Name : Influenza A H3N2 (A/Hong Kong/45/2019) Nucleoprotein / NP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : H3N2Source : Baculovirus-Insect CellsTag :…
Name : Influenza A H3N2 (A/Hong Kong/2671/2019) Nucleoprotein / NP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : H3N2Source : Baculovirus-Insect CellsTag :…
Name : Influenza A H3N2 (A/Switzerland/9715293/2013) Nucleoprotein / NP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : H3N2Source : Baculovirus-Insect CellsTag : Protein…
Name : Influenza A H3N2 (A/Hong Kong/1/1968) Nucleoprotein / NP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : H3N2Source : Baculovirus-Insect CellsTag :…
Name : Influenza A H3N2 (A/Aichi/2/1968) Nucleoprotein / NP Protein (His Tag)Biological Activity : Background : Biological Activity : Testing in progressExpression Host : H3N2Source : Baculovirus-Insect CellsTag : Protein…
Name : Influenza A H3N2 (A/Massachusetts/18/2022) Neuraminidase / NA Protein (ECD, His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is…
Name : Influenza A H3N2 (A/Hong Kong/01/1968) Neuraminidase / NA Protein (ECD, His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(K417N)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H3N2 (A/Darwin/6/2021) Neuraminidase / NA Protein (ECD, His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is…
Name : Influenza A H3N2 (A/Darwin/9/2021) Neuraminidase / NA Protein (ECD, His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is…
Name : Influenza A H3N2 (A/Hong Kong/2671/2019) Neuraminidase / NA Protein (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is…
Name : Influenza A H3N2 (A/England/42/1972) Neuraminidase / NA Protein (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a…
Name : Influenza A H3N2 (A/Singapore/INFIMH-16-0019/2016) Neuraminidase / NA Protein (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a…
Name : Influenza A H3N2 (A/Cambodia/e0826360/2020) Neuraminidase / NA Protein (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a…
Name : Influenza A H3N2 (A/Kansas/14/2017) Neuraminidase / NA Protein (ECD, His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is…
Name : Influenza A H3N2 (A/swine/China/JG20/2019) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : Influenza A H3N2 (A/Australia/NHRC0001/2005) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : Influenza A H3N2 (A/Hong Kong/CUHK19579/1998) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(A352S)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H3N2 (A/Amsterdam/4112/1992) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : Influenza A H3N2 (A/swine/Italy/526/1985) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : Influenza A H3N2 (A/Hong Kong/107/1971) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a…
Name : Influenza A H3N2 (A/Albany/18/1968) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : Influenza A H3N2 (A/Hong Kong/4801/2014) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a…
Name : Influenza A H3N2 (A/Hong Kong/4801/2014) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a…
Name : Influenza A H3N2 (A/Aichi/2/1968) Neuraminidase / NA (Active)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of…
Name : Influenza A H3N2 (A/Aichi/2/1968) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : Influenza A H3N2 Neuraminidase / NA (H274Y mutation) (Active)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : Influenza A H3N2 Neuraminidase / NA (R292K mutation) (Active)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(P479S)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H3N2 Neuraminidase / NA (N294S mutation) (Active)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : Influenza A H3N2 Neuraminidase / NA (E119V mutation) (Active)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : Influenza A H3N2 Neuraminidase / NA (Active)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase…
Name : Influenza A H3N2 (A/Babol/36/2005) Neuraminidase / NA (His Tag)Biological Activity : Background : Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type…
Name : Influenza A H3N2 (A/Aichi/2/1968) Matrix protein 1 / M1 Protein (His Tag)Biological Activity : Background : The Influenza virus matrix protein 1 (M1) is a matrix protein of…
Name : Influenza A H3N2 (A/Massachusetts/18/2022; A/Thailand/8/2022) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H3N2 (A/South Australia/34/2019) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H3N2 (A/Switzerland/8060/2017) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H3N2 (A/Darwin/6/2021) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H3N2 (A/Darwin/6/2021) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(E471Q)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H3N2 (A/Darwin/9/2021) Hemagglutinin / HA trimer Protein (His Tag)(HPLC-verified)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H3N2 (A/Darwin/9/2021) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H3N2 (A/Darwin/9/2021) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H3N2 (A/Minnesota/41/2019) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Cambodia/e0826360/2020) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Cambodia/e0826360/2020) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Hong Kong/45/2019) Hemagglutinin / HA trimer Protein (His Tag)(HPLC-verified)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor…
Name : Influenza A H3N2 (A/Hong Kong/45/2019) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza B (B/Washington/02/2019) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket on…
Name : Influenza A H3N2 (A/Hong Kong/2671/2019) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(N440K)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H3N2 (A/Hong Kong/1/1968) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H3N2 (A/Ohio/14/2008) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Mexico/InDRE2250/2005) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/swine/Miyazaki/2/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/swine/Mexico/AVX13/2012) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/swine/Thailand/CU-P53/2012) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/swine/Colorado/A01203748/2012) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/swine/Denmark/101501-1/2010) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/swine/Spain/33601/2001) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/swine/England/90591/1997) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(K444R)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H3N2 (A/Singapore/INFIMH-16-0019/2016) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Hong Kong/4801/2014) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H3N2 (A/Switzerland/9715293/2013) Hemagglutinin / HA0 Protein (full length)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Switzerland/9715293/2013) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Switzerland/9715293/2013) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Missouri/09/2014) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Missouri/09/2014) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Hanoi/EL201/2009) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Hanoi/EL201/2009) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Hanoi/EL134/2008) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(G482S)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H3N2 (A/Hanoi/EL134/2008) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Fujian/411/2002) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Fujian/411/2002) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Philippines/472/2002) (MDCK) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H3N2 (A/Philippines/472/2002) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Netherlands/178/1995(RG145K)) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Netherlands/178/1995) (RG145K) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H3N2 (A/Nanchang/933/1995) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Nanchang/933/1995) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Beijing/32/1992) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(G485S)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H3N2 (A/Beijing/32/1992) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Guizhou/54/1989) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/England/42/1972) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/England/42/1972) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Comparison of your implies amongst three groups was performed utilizing one-way ANOVA followed by post-hoc test (LSD or Tamhane's T2). P0.05, P0.01, P0.001. TIPE2, tumor necrosis element a nduced protein…
Planet Well being Organization declared the disease a international pandemic. Throughout 2020, Michigan endured two dramatic surges of COVID-19 all through communities across the state. In Washtenaw County, exactly where…
Name : Influenza A H3N2 (A/Christchurch/4/1985) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Texas/1/1977) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Johannesburg/33/1994) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Johannesburg/33/1994) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Wuhan/359/1995) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/New York/55/2004) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(G446V)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : Influenza A H3N2 (A/Chiang Rai/277/2011) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H3N2 (A/Victoria/3/1975) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Indiana/07/2012) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Texas/50/2012) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Texas/50/2012) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Moscow/10/1999) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Moscow/10/1999) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Babol/36/2005) Hemagglutinin / HA0 ProteinBiological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket on the…
Name : Influenza A H3N2 (A/Babol/36/2005) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H3N2 (A/Guangdong-Luohu/1256/2009) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(A475V)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : SARS-CoV-2 (2019-nCoV) Nucleocapsid(P13L)-His Recombinant ProteinBiological Activity : Background : Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry. Coronavirus nucleoproteins localize…
Name : Human CD3 (humanized OKT3) Antibody-Human IgG4 (GMP-grade)Biological Activity : Background : T-cell surface glycoprotein CD3 epsilon chain, also known as CD3e, is a single-pass type I membrane protein.…
T strategy of evaluation is often made use of to investigate periodic structures of hepatitis A, B, C and E infection information in detail, and valuable information on periodic structures…
H miRNAs-specific 5 forward primer and 3 universal backward primers provided by the manufacturer with the initially strand cDNA synthesis kit (Takara Cat: 683183). Each reaction was performed within a…
Zumab.Therapies for NSCLC brain metastases3.4 ORREleven radiotherapy-related trials about eight types of treatments reported ORR (Figure 4a). Radiotherapy + nitroglycerin showed a important advantage over radiotherapy alone on ORR (RR:…
4]. The epidemiology of unique MRSA strains has been investigated comprehensively , but data regarding PVL-carrying MRSA in Germany are fairly scarce or restricted to outbreak investigations . We hypothesize…
Bring about water absorption cracks and consequently minimize the strength on the composite. . The weak compatibility of fiber/matrix coupling can be elevated by the remedy on the fiber surface…
Name : Influenza A H3N2 (A/Texas/50/2012) Hemagglutinin Protein (HA1 Subunit) (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Texas/50/2012) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Moscow/10/1999) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Moscow/10/1999) Hemagglutinin / HA Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : Influenza A H3N2 (A/Babol/36/2005) Hemagglutinin / HA0 ProteinBiological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket on the…
Name : Influenza A H3N2 (A/Babol/36/2005) Hemagglutinin / HA Protein (ECD, His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding…
Name : Influenza A H3N2 (A/Guangdong-Luohu/1256/2009) Hemagglutinin / HA1 Protein (His Tag)Biological Activity : Background : The influenza viral Hemagglutinin (HA) protein is a homotrimer with a receptor binding pocket…
Name : SARS-CoV-2 (2019-nCoV) Spike RBD(A475V)-His Recombinant ProteinBiological Activity : Background : The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host…
Name : SARS-CoV-2 (2019-nCoV) Nucleocapsid(P13L)-His Recombinant ProteinBiological Activity : Background : Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry. Coronavirus nucleoproteins localize…
Name : Human CD3 (humanized OKT3) Antibody-Human IgG4 (GMP-grade)Biological Activity : Background : T-cell surface glycoprotein CD3 epsilon chain, also known as CD3e, is a single-pass type I membrane protein.…
Xidant activity as compared 70 terrestris methanol extract exhibited superb antioxidant activity as in comparison to to 70 meth and dichloromethane extracts. This be attributed in element for the to…
Aromatic ( ) drate ( ) Carbon b Carbon c 148 ppm 14865 ppm 13 16590 ppm 19020 ppm Carbon a 453 ppm 633 ppm Table two. Integration final results…
Eting DNA methylation was reflected in the corresponding improvement in mtDNA copy no., by 22 in Di-I/R rat hearts compared with I/R hearts. I/R heartsFrontiers in Cardiovascular Medicinefrontiersin.orgBoovarahan et al.ten.3389/fcvm.2022.FIGUREDNA…
LD formation (reduces lipid toxicity) along with the protein load and folding capacity of your ER. Squalene is discovered in the middle of a lipid bilayer and is stored in…
D problems of mass incarceration is important for all researchers who strategy to conduct function in this space. Framework for Identifying Important Stakeholders In Fig. 1, we use the sequential…
Nd Williams 2011). The 2 ligands and opioids (low doses) offer efficacious option treatment options but in addition have their limitations and unwanted side effects. The mechanism of action accountable…
R dosing regimens. The blue line may be the median concentration, along with the shaded region would be the 95 prediction interval. The red strong line represents the in vitro…
A lot more comparative research are required to correctly establish the justification of its usage in infant CT angiography.Funding: This study received no external funding. Institutional Assessment Board Statement: Not…
By a dense desmoplastic reaction and anCorrespondence to: Prof. Changhoon Yoo, Department of Oncology, Asan Health-related Center University of Ulsan College of Medicine, 88 Olympic-ro 43-gil, Songpa-gu, Seoul 05505, Korea.…
Eg. Fat reduction Pos. Neg. History of Other Tumor Pos. Neg. Chronic Illness Pos. Neg. History of Surgery Pos. Neg. History of Trauma Pos. Neg. Allergic History Pos. Neg. Marriage…
Thenate and CoA pathways and amino acid metabolism including phenylalanine and tyrosine in EPI.Chen 2021 N/ACerebrospinal Fluid (CSF) Akiyama 2020 EPI CT 34 30 CSF 07 y Post-Mortem Brain Post-Mortem…
C one, was t tively assigned to hexoside of hydroxybenzoic acid - m/z 137.Nutrients 2022, 14, 2287 ten of3.three. The Analysis of Time-Dependent Adjustments of Metabolites soon after Gut Microbiota…
DmX. The meshes represent the final j2Fo 2 Fcj electron density map contoured in the 1.0-s level for the complexes of AdmXLBD with IAA and IPA. (B) Amino acid residues…
. Briefly, Raw264.7 mouse macrophages have been seeded in 24-well plates at a density of 1.five 105 cells/well. Just after 24 h, cells have been treated with LPS and many…
Min D deficiency is linked to a danger of miscarriage and a few authors advocate for the introduction of level measurement prior to pregnancy . As much as date, there…
Ination study of isatuximab with Pd.9 To strengthen the choice of your dose, we performed further E-R analyses with 52 of 57 evaluable sufferers with RRMM from a phase Ib…
Ted as a sum of danger variants that have been a lot more important than a prespecified threshold (see beneath) weighted by the impact sizes from the GWASs. To include…
Est (Table eight) show that the filler can have an effect on each the stiffness and flexibility with the vulcanizate. The talc-filled sample increases its all round mechanical strength by…
Viewed as the theoretical partial discharge inception voltage. Either or both the processes described earlier (gas discharge and surface inception voltage. Either or each the processes described earlier (gas discharge…
D in this paper advantage the reader in additional pursuing individual amplicon sequencing at the same time as processing experiments.Abbreviations ABZ: Albendazole; ASVs: Amplicon sequence variants; FEC: Fecal egg count;…
On, analysis, and interpretation of information and in writing the manuscript. Availability of information and supplies The datasets utilised and/or analyzed during the existing study are obtainable from the corresponding…
H2 S production in wild-type (wt) and mutant cells, the lead acetate detection process was utilized . Paper strips saturated by 2 of Pb(Ac)2 have been affixed for the inner…
S have been removed by size exclusive chromatography (Sepharose 4B, Sigma-Aldrich) eluted with 10 mM HEPES, pH 7.04. The eluted fraction containing HPTS-loaded liposomes was collected and utilized within 48…
Sozymes encoded by the LOX genes (CaLOX1--CaLOX8) identified inside the transcrip LOX isozymes encoded by the LOX genes (CaLOX1--CaLOX8) identified inside the transcriptome of tome of Californiatype sweet pepper fruits.…
In technique . Interestingly, in AD sufferers, at the same time as in AD mouse models, the plasma contact system has been identified to be in an activated state. This…
Atments inside the vast majority of GBM patients. This constitutes a basic prerequisite for the usage of spheroids for the discovery of efficient therapies within this presently incurable tumor .…
EntElectrode fixture implantation and applicationExperimental animals had been anesthetized with two.5 isoflurane mixed with 34 oxygen and 66 nitrous oxide. A rectal thermometer (TR-100), in conjunction with a heating pad…
Ctrostatic interaction in between + Glu62, a residue belonging to NMP binding area, and H3 group of ionized amantadine. The identical residue, Glu62, interacts together with the H2 group on…
Ion items of At and SMT using MIL-100(Ti) had been thus independently analyzed. Earlier research have described the photochemical behavior of At and SMT, figuring out that the degradation happens…
. Cox regression confirmed that the danger score was a element that independently predicted the prognosis of individuals with TGCTs. (G, H) AUC, region beneath the curve; TGCT, testicular germ…
Urce of information to enrich baseline study traits for adjustment purposes. Even though the road ahead for CF clinical improvement is probably to be challenging with an ever-changing landscape of…
D fatty acids in cellular membranes and was shown to prime apoptotic signals by escalating NF-B activity while decreasing IB degradation and inducing the phosphorylation of antiapoptotic Bcl2 . In…
Ll cycle arrest, cells. 5-Demethyl NOB inhibits leukemia cell proliferation throughthrough the regulation of cell cycle arrest, apoptosis, cell differentiation, cell the NF-B/TNF--mediated inflammatory response. apoptosis, cell differentiation, cell growth,…
Nduced currents TRPV1-HEK cells when each dihydroceramide was applied alone in the absence of capsaicin. (D,E) recorded within the presence of either PBS, PEDHC (1 /mL), or PGDHC (1 /mL)…
Nvolved remains beyond speculation.sieve tubes with out intervention of membrane-located transporters. It appears beyond doubt that phytoplasmas exploit the absence of AtCALS7 for better recruitment of resources for growth and…
Im Taken collectively, these information suggest that GDNF induced modifications both in frequency and munostainings for gephyrin, a scaffolding protein for glycine and GABAA receptors , amplitude of IPSCs. Furthermore,…
Including macrophages, T cells, lung epithelial cells and mast/basophils In macrophages, we observed that T at ten M inhibited LPS-stimulated nitrite formation and decreased iNOS expression . In a further…
.L. Fattore et al.Cancer Epidemiology 79 (2022), mortality risk differs among cancer individuals and results are occasionally contradictory. Around the a single hand, because of the physiological aging process and…
O identified six positively chosen sites present in panda bear, two of that are panda-specific and not discovered in any other mammalian GPR84, namely Leu152 and Ala249 (numbering according to…
, along with the target selection of exposure determined. The RDE was chosen according to the simulated PK profiles and the estimated target exposure range.Exposure esponse evaluation for biomarkerThe ER…
Of surface patterns was detected for TFA at displacements of 0.30 mm and higher and substantial for DPA only at a displacement of 0.10 mm. Surface patterns in both DPA…
Epends on JA ratios and storage instances (imply SD). Experimental Yogurts Handle JA1 JA2 JA3 Storage time (days) Control JA1 JA2 JA3 Control JA1 JA2 JA3 Control JA1 JA2 JA3…
Too as anti-CD4/anti-CD8 depleting antibodies. (F) WT mice reconstituted with super p53 versus WT bone marrow inoculated with B16 melanoma after which treated with anti D-1 antibody. (G and H)…
N the case of Proteus, isolates of P. vulgaris have been resistant, 4/4(one hundred ) against two drugs tested (gentamicin, and trimethoprim-sulfamethoxazole), and 3/4(75 ) were resistant to chloramphenicol. Moreover,…
, terpenoids, extract glycosides, steroids, saponins and phenols. The presence of those phytoconstituents may possibly glycosides, steroids, saponins and phenols. The presence of these phytoconstituents may glycosides, steroids, saponins and…
, but not the more polar solvent, dH2O, at 40 soon after 10 days of migration testing. Sodium fluoride dissolves more freely in MeOH because the temperature of your solvent…
G) was accomplished by the larvae fed on WB/RC. The most spectacular development depending on LWG was recorded for larvae fed on WB/SMc, where the LWG reached 50.40 mg in…
Piratory pressure signal), pause and enhanced pause (pause peak expiratory flow/peak inspiratory flow). No important effects of compound KM-408 on the tested parameters had been observed over the 4-h test…
O test this possibility, we examined miR-21 levels in WT, DNA-PKcs-/- or Rad54-/- cells employing a distinct ATM or ATR inhibitor. We irradiated cells with five Gy to enhance the…
G ez-Cort De La Fuente, 2017; Jensen et al., 2010; Nishimura et al., 2014; Spector Kim, 2015; Vega et al., 2012). Human milk might include trans fatty acids (TFAs), that…
, but its part in ocular infection is limited . The usage of in vivo confocalmicroscopy has also been described to diagnose PI; however, the functions usually are not characteristic…
Enhanced expression with the astroglial intermediate filament GFAP. In addition, it alters the homeostatic functions of astrocytes, like the uptake of glutamate to prevent neurotoxic extracellular accumulation . While astrogliosis…
Ables.ConclusionsStromal cell markers CD55, CD248, FAP and podoplanin are expressed in ST inside the earliest stage of arthritis. Baseline expression of FAP is larger in early synovitis patients who fulfil…
Ll, a total of 20 college kids have been randomly selected from either one or two villages in each township. A total of 2,240 children from 146 villages and 112…
Establishing female cerebellum, as when compared with males and androgenized females. These data show that the neurofilament cytoskeleton inside the establishing rat cerebellum exhibits resistance to AraC that seems sexually…
E to cold anxiety for 5 days, we observed the ultrastructure changes attributable to virus infection. Transmission electron microscopy (TEM) was employed to evaluate the structure of non-stressed and non-silenced…
De Biofisiofarmacologia, Campo Grande, MS, Brasil four Universidade Federal de Mato Grosso do Sul, Centro de Ci cias Biol icas e da Sa e, Laborat io de Tecnologia Farmac tica,…
Irst-generation 5-HT3 RAs . PALO allosterically binds for the 5-HT3 receptors with optimistic cooperativity, which probably triggers the internalization of these receptors, major to persistent inhibition of their function .…
Ojection neurons are glutamatergic or GABAergic (Jackson et al., 2009; Bang and Commons, 2012). Additionally, subsets of DRN 5HT neurons coexpress glutamate or GABA (Commons, 2009; Shikanai et al., 2012).…
Rosclerosis. Cardiovasc Pathol. 2006;15(six):318sirtuininhibitor0. 58. Koba S, Hirano T. . Nihon Rinsho. 2011;69(1):138sirtuininhibitor3. 59. Mallika V, Goswami B, Rajappa M. Atherosclerosis pathophysiology and also the function of novel threat things:…
H PAS domains along with a preceding predicted helix-loop-helix motif.44 The recruitment of PER1 towards the PPAR binding area within the Ccr2 promoter implied that PER1 may bind to PPAR-…
Emory.edu. 2Current Address: Division of Psychiatry and Behavioral Sciences, Emory University College of Medicine, 4000 Woodruff Memorial Bldg., Atlanta, GA 30322 Publisher's Disclaimer: This is a PDF file of an…
Ockdown promotes tumor cell proliferation, and enhances cellular transformation and tumorigenesis (47), when other groups demonstrated that Dicer knockdown suppresses the growth and tumorigenic capacity of different cancer cell lines…
Value on comprehensive baseline and follow-up pulmonary function testing to greater recognize sufferers with accelerated lung function decline and also a low worth around the costs related with these tests.…
Ular therapies, and other folks. The rational style of targeted agents appears to address elderly patients' unmet wants with respect to enhanced efficacy and tolerability. Using the introduction of these…
Ild-type Htt (Htt-23Q) in the cell bodies of neuronal and astrocytic cells (Fig. 1D , *p 0.05, **p 0.01). mHtt is cleared gradually in neuronal processes Figure four. Proteasomal inhibitors…
Runing T et al. Development of a multi-compartment pharmacokinetic model to characterize the exposure to HexamollDINCH Chemosphere 2015; 128: 21624. 23 Lorber M, Angerer J, Koch HM. A uncomplicated pharmacokinetic…
Fees, non-financial help and other from Chiesi, Astrazeneca, GlaxoSmithKline, Boehringer Ingelheim, Merck Sharp Dohme, Pfizer, Takeda, and Mundipharma (outdoors the submitted work); individual fees and non-financial support from Menarini, Novartis,…
Response (Gordon and Taylor, 2005). Two Msubsets are recognized, known as M1 and M2, which outcome from classical or alternative activation, respectively (Nathan, 1991; Gordon, 2003). Classical (M1) activation of…
Eneral linear models adjusted for season of blood collection, country, qualities (gender, BMI, smoking status), serum cholesterol, dietary intake (fruit, vegetables, juice, French fries, and meat), and use of vitamin…
Ompared to 1.0 six 0.03 in control-treated embryos .Canonical Wnt Signaling Persists in Mature dI1 NeuronsBecause the mRNAs of Lrp5 and Lrp6 have been clearly detected only in precursors of…
D NP nuclear import and subsequent Flu viral titre twofold Mutation with the IMP3 recognised NLS in PB1 final results inside a 4-log10 reduction in virus titre Mutation of PB2…
Tions interacts with BP-diol and BPDE major to inhibition of PARP and to a synergistic enhance in DNA damage. On the other hand, considering that BaP did not trigger a…
Ted complicated sample (0.26) was also subjected to measurement for comparison of the absorption peak profiles.More file 3: Preparation of rFab'-MTZ. a) SDS-PAGE evaluation of pepsin digestion of whole rabbit…
Groups (Fig 5A). Messenger RNA abundance for the glutathione peroxidase (GPX) and peroxide redoxin (PRDX5) genes were similar in embryos from all the therapies (Fig 5B and 5C P 0.05).…
Et al.21 identified a specific relationship amongst B. bassiana transcriptome from cells created through unique environmental and developmental conditions (aerial conidia, in vitro blastospores and submerged conidia) plus the utilization…
Reductase inhibition, type 2 diabetes, and bodyweight: proof from genetic analysis and randomised trials. Lancet. 2015;385:3511. 14. Robinson JG. Statins and diabetes chance: how serious is it and what are…
Pro-inflammatory cells in adipose tissue (three). Some numerous immune cell subsets, which includes macrophages, eosinophils, all-natural killer cells (NKs), NKT cells, and T cells, are significant in sustaining adipose tissue…
Res. 2015 Mar 30;6(1):e6. Sattapan B, Nervo GJ, Palamara JE, Messer HH. Defects in rotary nickel-titanium files just after clinical use. J Endod. 2000 Mar;26(three):161-5. Shen Y, Cheung GS, Bian…
Of present episode, month 13. Baseline depression symptom score 14. Baseline high quality of life and functioning score 15. Preceding and/or ongoing secondary psychiatric disorder (anxiousness disorder, externalising disorder (ADHD,…
Ta, classified nuclear ERCC1 and DPD expression as absent, weak, moderate, or robust. Tumors with weak to robust expression had been defined as "positive," and tumors not expressing these proteins…
Ch model the hypoxic microenvironment of solid tumor, have established to be a valuable in vitro model to study the dual part of this TF in diverse contexts. For instance,…
Above ground biomass of person plant was harvested in every season and fresh weight (FW) per plant was recorded. The dry AGB for each and every plant was determined by…
Ion, following which granulocytes and lymphocytes appeared and ulceration occurred, as reported previously . However, inside the present study, no crust formation, ulceration, gangrene, or autoamputation had been observed within…
Established within this investigation indicates that HMGB1 can promote IL-17 expression and inflammation in HB. Our outcomes demonstrate that the inhibition of HMGB1/RAGE interaction can minimize inflammation in HB. This…
Nancies. Cancer 112, 274sirtuininhibitor83, doi:10.1002/cncr.23159 (2008). 15. Ito, T. et al. Epidemiological study of gastroenteropancreatic neuroendocrine tumors in Japan. J Gastroenterol 45, 234sirtuininhibitor43, doi:ten.1007/s00535-009-0194-8 (2010). 16. Oberg, K. Eriksson, B.…
E applied as a designer vaccine adjuvant to activate multiple arms of your innate immune response in lymph nodes. By aminating carboxyl groups in -PGA nanomicelles, the immunologically inert nanomicelles…
P (TG+VC group).increased within the TG+DG group, but the increase ratio varied (Figure 5). Additionally, a equivalent enhancement was observed in the p-JNK degree of the TG+DG brain. DG pretreatment…
Rtant part in follicular improvement, GC proliferation, and reproductive processes. Exogenous FSH is extensively utilised to stimulate the development of mature follicles due to its effectiveness in stopping GC apoptosis…
Fibril formation really effectively, revealing that the involvement of your -domain is usually a crucial step in the formation of amyloid fibrils by human lysozyme. These investigations demonstrate additional the…
G gel. Vertical SDS-PAGE electrophoresis as the second dimension was run until bromophenol blue reached the bottom on the gel.Analysis of Volatile Compounds in the Urine by HS-SPME-GC-MSExtractionThe extractor (65…
Nd the number of laminin-positive blood vessels (C) in P7 cortex of Yapf/f and Yapnestin-CKO mice (n = 8 per group) as shown in (A). (D and E) Quantitative evaluation…
Aneous, irreversible -- Restricted sirtuininhibitorMetabolism -- Non-hepatic sirtuininhibitorHydrolysis -- Hepatically mediated sirtuininhibitorHydrolysis sirtuininhibitorHydroxylation sirtuininhibitorDealkylationClCancer Chemother Pharmacol (2015) 75:1143sirtuininhibitorBendamustineN N O OH Cl N CHd Hyys isx roolylaHy drtioClClnHPN N O…
OrLOQ sirtuininhibitorLOQ sirtuininhibitorLOQ 0.001 sirtuininhibitorLOQ 1.61 Maximum 13.6 2.ten 1.34 9.49 0.63 0.83 91.4 7.92 0.32 41.9 51.9 12.6 three.90 44.4 2214 134 0.51 17.six 208 1.87 1.97 0.36 4.97…
O assess the expression of adipogenic genes and ERs (Supplementary Table two, see section on supplementary information provided at the end of this short article). -actin was made use of…
One particular patient in Heparin plus GPI, and none in Heparin alone arm. In EUROMAX study, definite stent thrombosis was seen in 1.6 cases in Bivalirudin arm and 0.two in…
Ubated with or devoid of inhibitors of transport for instance cyclosporine A at 5 M together with Rh123 (1.three M) for 45 min or calcein-AM (0.5 M) for 10 min…
B1, Liver kinase B 1). (C) Mitochondrial biogenesis and upkeep of mitochondrial function decline with age and exercising does not appear to enhance the attenuation. (PGC1, Peroxisome proliferator--activated receptor gamma,…
Eggs may possibly clarify why it is actually stained even in the absence of PK. Removal of your vitelline envelope/chorion can also make sexual oviparous embryos more accessible to antibody.…
E interval. Statistical significance is denoted by asterisks (n510). Cll, reduced limit from the 95 self-confidence intervals; Clu, upper limit of the 95 self-assurance intervals; Con A, concanavalin A; CTC,…
Fig. 5A), along with the benefits indicated that PLA-chitosan-IM7 nano-particles could target the tumor cells and suppress their proliferation (Fig. 5B). A total of 35 days subsequent to PLA-chitosan-IM7 treatment,…
Digested and dephosphorylated pThiovector. The pThio-AtCCD7 was described previously (Alder et al., 2012). pThio-AtCCD4 was transformed into BL21 (DE3) Escherichia coli cells harboring the plasmid pGro7 (Takara Bio Inc.). Cells…
L.pone.0136862.g(Fig 3B) for all VLP immunogen groups. TitersL.pone.0136862.g(Fig 3B) for all VLP immunogen groups. Titers immediately after immunization with VLPs alone (0.135 OD), CALV(0)+VLP (0.265 OD), CALV(7.5)+VLP (0.348 OD), CALV(12.five)+VLP…
Evious study of juvenile Jian carp . It truly is well known that digestive enzymes in intestinal lumen are mainly secreted from pancreas . Hokin reported that threonine was vital…
); Concanavalin A (Con A) (B); (Con A) (B); or lipopolysaccharide and cell stimulated with: CD3/CD28 (A); Concanavalin Aor lipopolysaccharide (LPS) (C) for 72 h, (LPS) (C) for proliferation was…
Ngle-cell suspensions ready from bone marrow, spleens and livers by flow cytometry right after redNat Med. Author manuscript; available in PMC 2017 June 01.Guryanova et al.Pageblood cell lysis. Populations have…
Competing economic interest.CONCLUSIONS Metal ion binding to MST enzymes prevents the exchange of substrates and goods. As such, catalysis happens only when the enzyme has initially bound the substrate as…
. The relative abundance of intestinal bacteria in the hemodialysis individuals prior to and right after oral L-carnitine supplementation for 3 months. Fifteen individuals who had been receiving hemodialysis and…
O been shown to level, but not levels of m5 C . Finally, ABH1 has also been shown to demethylate N6 -methyladenine,preferably on single stranded DNA, suggesting that the demethylation…
Ediators intervention in clinical therapy of SAP accomplished no considerable efficacy, suggesting that blunt suppression of inflammation may possibly rather aggravate immune problems (28). Hence, the usage of immunomodualatory agents,…
Onooxymethytriptolide disodium salt, was synthesized by reacting triptolide with acetic anhydride in dimethyl sulfoxide at space temperature for five days (Chugh et al., 2012). Minnelide inhibits the growth of multiple…
Hallmark of serious retinitis yellow highlight. OPN, optic nerve; GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer; RPE (retinal pigmented epithelial cell layer) and choroid. d…
Ectiveness and Safety of NOACs vs WarfarinYao et alORIGINAL RESEARCHTable 5. Subgroup Evaluation in Propensity Score atched Rivaroxaban Versus Warfarin UsersRivaroxaban (n=16 175) Event RateWarfarin (n=16 175) Event RateRivaroxaban vs…
Terest may be discovered at the end of this article.The optimal initial therapy for sufferers with stage I I non-small celllungcancer(NSCLC)issurgicalresection.Intheappropriate setting,individuals with stage IIIA NSCLC might also be presented…
Inistrated volume (p value = 0.313) and the variety of the contrast medium (p worth = 0.273) have been equivalent between the 2 groups in our study. There was just…
IL). Electrospray ionization-MS was performed working with an Agilent 6120 Quadrupole MSD mass spectrometer (Agilent Technologies, Santa Clara, CA) equipped with an Agilent 1200 Series Quaternary LC program and an…
Ieved by re-suspending cells in 0.15 (w/v) collagenase I (Sigma) dissolved in DMEM for 1 h, person cells have been pelleted and rinsed twice with DMEM ahead of re-suspending inside…
Min, and trypsin (18 1). The expression of HAI-1 is increased throughout tissue remodeling and inflammation (22, 23), and it's believed to regulate activation of hepatocyte growth factor precursor. It…
ACATGACCCCACCGA-3' (item size, 127 bp) for Bcl-2; 5'-primer: 5'-CCATGGAACACCAGCTCCTG-3', 3'-primer: 5'-CGGTCCAGGTAGTTCATGGC-3' (itemACATGACCCCACCGA-3' (solution size, 127 bp) for Bcl-2; 5'-primer: 5'-CCATGGAACACCAGCTCCTG-3', 3'-primer: 5'-CGGTCCAGGTAGTTCATGGC-3' (solution size, 187 bp) for CyclinD1; 5'-primer: 5'-AATGAGTACCGCAAACGCTT-3',…
Ose production. (a) LLHG cells stably expressing the G6Pase promoterOse production. (a) LLHG cells stably expressing the G6Pase promoter having a luciferase reporter were serum starved for 6 h and…
PLEX-B) containing a single adduct of BBR3464 and no unplatinated duplexesPLEX-B) containing a single adduct of BBR3464 and no unplatinated duplexes was prepared and tested for its inhibitory impact. The…
Affairs. The funding agencies didn't participate in the design ofAffairs. The funding agencies did not take part in the design on the study and collection, evaluation, and interpretation of data…
In breast cancer cells . Additionally, they indicate that GLI1 can modulateIn breast cancer cells . In addition, they indicate that GLI1 can modulate proliferation not only in tamoxifen resistant…
Ve handle and DNA from regular lymphocytes was employed because theVe manage and DNA from regular lymphocytes was applied because the unmethylation-positive control. NEG, damaging control; Lane L1-L2, breast cancer…
The cells had been cultured in cell culture flasks within a humidifiedThe cells were cultured in cell culture flasks inside a humidified (RH 99 ) CO2-atmosphere (five ) at 37…
Grain + AR total DQ 4-d FR Power + energy Whole grain + wholeGrain + AR total DQ 4-d FR Power + energy Whole grain + entire grain Isoflavonoids +…
Transcripts or protein (Fig. 2A and B). In contrast to STINGTranscripts or protein (Fig. 2A and B). In contrast to STING, the IFI16 protein is expressed in all of the…
Phorylation is IL-21R, Mouse (217a.a, HEK293, His) stimulated by the TGES motif on the A domainPhorylation is stimulated by the TGES motif of your A domain, which undergoes large movements…
Orted in the studies105 consist of somnolence, fatigue, headache, ER beta/ESR2 Protein Purity & Documentation gastrointestinal effects (whichOrted in the studies105 consist of somnolence, fatigue, headache, gastrointestinal effects (which involve…
Oved DpR inside the final various regression model had been panitumumab remedyOved DpR inside the final multiple regression model were panitumumab treatment (vs. FOLFOX4 alone), liver-only metastatic illness (vs. liver…
R the induction ofCell Signal. Author manuscript; obtainable in PMC 2018 OctoberR the induction ofCell Signal. Author manuscript; accessible in PMC 2018 October 01.Zhou et al.PageEMT. Offered the proof that…
Veries were produced inside the mid 1960's, culminating inside the landmarkVeries have been created in the mid 1960's, culminating within the GIP Protein supplier landmark discovery that nucleoli will be…
Lts on the photocatalytic measurements following trend: in sirtuininhibitorTACF RIPK3 Protein Formulation TACRTable two. sirtuininhibitorTACBICLts of your photocatalytic measurements following trend: in sirtuininhibitorTACF TACRTable two. sirtuininhibitorTACBIC sirtuininhibitor TAC. The outcomes…
Suggests that the main function on the Haller's organ isSuggests that the principal part from the Haller's organ is olfaction, and that there's a secondary chemosensory organ in ticks, probably…
S as follows: (-), negative samples; (+), Olivero blot detectable expression asS as follows: (-), adverse samples; (+), Olivero blot detectable expression as in et al., 1996 2. IHC the…
A combination of MMS and PI led to a considerable reductionA combination of MMS and PI led to a substantial reduction in creatine concentration18. This suggests that there exists a…
E which has previously been shown to mimic the footshock-induced riseE that has previously been shown to mimic the footshock-induced rise in plasma CORT. Groups had been studied simultaneously and…
Spleens then passing the tissue fragments through a 70 m nylonSpleens and then passing the tissue fragments via a 70 m nylon mesh. Red blood cells (RBCs) from spleens had…
Sed as an input parameter. The powders had been dried inside aSed as an input parameter. The powders have been dried inside a tube by flushing with nitrogen for 30…
Potentially life threatening predicament. Plasmapheresis is really a therapeutic selection in suchPotentially life threatening circumstance. Plasmapheresis is a therapeutic option in such an emergency in swiftly lowering TG and has…
M #2 #2+Vem 6 eight Days ten 12 6 Days eight 10dControl-sh Vem Tumor SOX10 ERBB3 FOXD3 pERKM #2 #2+Vem six eight Days ten 12 6 Days 8 10dControl-sh Vem…
Nary function in examined. sirtuininhibitor 0.1). See two.two. MATERIAL AND Solutions IL-27 Protein Formulation examinations areNary function in examined. sirtuininhibitor 0.1). See 2.2. MATERIAL AND Techniques Examinations are done in…
Temodified yellowgreen (YG) microspheres have been purchased from Invitrogen (Thermo Fisher scientificTemodified yellowgreen (YG) microspheres were purchased from Invitrogen (Thermo Fisher scientific, Waltham, MA, USA). FITC-anti-F4/80, PE-anti-CD11b and PE-anti-CD206 had…
Data, inflammatory cytokine levels for example hs-CRP, TNF-, leptin, and PAI-Data, inflammatory cytokine levels like hs-CRP, TNF-, leptin, and PAI-1 had been considerably higher in the PDGF-BB, Human overweight and…
E treated with 0, 20, 40 or 80 POA for 24 h. (A) The percentage ofE treated with 0, 20, 40 or 80 POA for 24 h. (A) The percentage…
S PKC-epsilon activation was showed to TARC/CCL17 Protein Gene ID shield type-1 diabetic heart . ItS PKC-epsilon activation was showed to safeguard type-1 diabetic heart . It was not determined…
A secondary messenger generated by bacteria, is reported to bind STINGA secondary messenger generated by bacteria, is reported to bind STING directly . In the course of recognition of intracellular…
Ranching processes, a number of which envelop blood vessel, and form bloodRanching processes, a few of which envelop blood vessel, and kind blood rain barrier (BBB) with endothelial cellsand pericytes.…
S and clinicopathological parameters. Table VI presents the methylation status ofONCOLOGYS and clinicopathological parameters. Table VI presents the methylation status ofONCOLOGY LETTERS 12: 5145-5155,Table III. Diagnostic functionality of candidate genes.…
Ients in the other regimens had been chosen depending on the aboveIents in the other regimens have been chosen based on the above figure to create the AZT to TDF…
Keletal Carboxylesterase 1 Protein MedChemExpress muscle that endogenous circulating MG53 contributes to protection against I-RKeletal muscle that endogenous circulating MG53 contributes to protection against I-R injury, and remedy with rhMG53…
Ly, a longacting phosphodiesterase kind five (PDE-5) inhibitor, initially in the USLy, a longacting phosphodiesterase sort 5 (PDE-5) inhibitor, initially in the US in 2011 and subsequently inside the EU…
Basis(10). These findings are similar to our benefits which demonstrated thatBasis(ten). These findings are similar to our final results which demonstrated that these lean women who consumed higher proportion of…
Antifungal agent (e.g., anidulafungin) or adjuvant (e.g., P3CSSAntifungal agent (e.g., anidulafungin) or adjuvant (e.g., P3CSS) and (ii) prior use in biomedical analysis, i.e., new potential APIs (e.g., MX-2401). As some…
The water surface. The water temperature was TROP-2 Protein manufacturer maintained at about 23 C.The water surface. The water temperature was maintained at about 23 C. The protocol was fixed…
Hase of a psoriatic lesion includes a close interplay amongst externalHase of a psoriatic lesion includes a close interplay in between external things and genetic alterations that predispose towards the…
Eletion of Lats2 in liver-specific Sav1 knock-out mouse model accelerated tumorigenesisEletion of Lats2 in liver-specific Sav1 knock-out mouse model accelerated tumorigenesis, confirming the existence of a bona fide unfavorable feedback…
The fluorophore into intracellular space. Due to the fact FITC NP efficiently resides inThe fluorophore into intracellular space. Since FITC NP efficiently resides in cells, the FITC smearing was only…
Pported by the NIH (RO1 AI088001) along with a grant in thePported by the NIH (RO1 AI088001) and a grant from the UWM research foundation (RGI 101X219).Obesity or overweight has…
For 24, 48 or 72 h, 10 from the CCK-8 assay answer was added intoFor 24, 48 or 72 h, 10 with the CCK-8 assay solution was added into every…
Same complex, and it really is feasible that the dimer crystal structureIdentical complicated, and it is actually feasible that the dimer crystal structure was stabilized by the crystal contacts.34 Nonetheless,…
Inhibitor 0.05 versus Ros and palmitate co-treated group. All outcomes are representativeInhibitor 0.05 versus Ros and palmitate co-treated group. All outcomes are representative western blots of 3 independent experiments with…
Atistical significance of your overlap is usually a better predictor ofAtistical significance in the overlap might be a superior predictor of cross-talk than absolute shared numbers. It must also be…
An SHH (rhSHH) remedy on proliferation of AGS (prime panel) andAn SHH (rhSHH) treatment on proliferation of AGS (best panel) and G-CSF Protein Purity & Documentation SGC-7901 (bottom panel) cells.…
four. Cell viability of A549 cells. (A) 24 h and (B) 48 h exposurefour. Cell viability of A549 cells. (A) 24 h and (B) 48 h exposure to Ni metal…
D Cl atoms in green. The heme is shown with CD Cl atoms in green. The heme is shown with C atoms in magenta. The 2Fo Fc electron density map…
Es). Mice were sacrificed by CO2 after which perfused slowly throughEs). Mice had been sacrificed by CO2 and after that perfused slowly by way of the ascending aorta with 30…
Ct particle size SPARC, Human (HEK293, His) transform (coalescence, flocculation) and phase separation (sedimentation, creamingCt particle size change (coalescence, flocculation) and phase separation (sedimentation, creaming). We prepared 20 mL of…
Didate genes and to discover their potential use as a biomarkerDidate genes and to discover their prospective use as a biomarker for the diagnosis of breast cancer. A total of…
Rticle CRISPR-Cas9 Protein site suspensions for 4 and 24 h in 24 well plates. The comet assayRticle suspensions for 4 and 24 h in 24 nicely plates. The comet assay…
Ing muscle excitability in DSG3 Protein custom synthesis vivoThe efficacy of bumetanide and acetazolamide to defend against a transient loss of muscle excitability in vivo was tested by monitoring the…
Sus 7.01?.65 at 1 h, 0.01; 4.30?.82 Leptin Protein web versus 6.91 ?0.79 at 1.5 h, 0.01; four.00 ?0.79 versus six.21 ?1.40 at two h, 0.01, separately) (see Figure 2).…
Ng mesalamine had urine levels of phthalates that exceeded FDA advisableNg mesalamine had urine levels of phthalates that exceeded FDA suggested levels. Although no equivocal proof exists, gastroenterologists treating UC…
Increased expression of NaV1.7 and NaV1.eight and CaV3.two protein (Fig. 3BEnhanced expression of NaV1.7 and NaV1.8 and CaV3.two protein (Fig. 3B) and CCL2 release (105 six versus 42 2.7 ngml)…
Ive efficacy of NSAIDs at doses appreciably higher than those necessaryIve efficacy of NSAIDs at doses appreciably greater than those necessary for anti-inflammatory effects. By way of example, celecoxib brought…
Randial coverage calls for the addition of rapidacting insulin to basal insulin. To prevent absolutely free mixing, pharmaceutical organizations have created premixed insulin analogues. These consist of a single formulation…
Ic target due to its significance in a assortment of critical biological processes. The cholinergic technique has been shown previously to be a major modulator of VEGF-A Protein Source parasite…
Lations. Variations in breathing pattern (sinusoidal versus continuous inhalation) and rotationLations. Differences in breathing pattern (sinusoidal versus continuous inhalation) and IRF5 Protein custom synthesis rotation pattern (continuous rotation by way…
Ith PRT062607 to suppress B-cell function. No adjustments have been observed inIth PRT062607 to suppress B-cell function. No changes had been observed in the percent of circulating B cells in…
Sis identified a SFRP2 Protein MedChemExpress number of determinants of inherent resistance that happen to be upstream of your targeted MEK. These determinants include up-regulation of alternative oncogenic growth issue…
T regulates the cell cycle (both SMAD dependent and SMAD independent) by inhibiting cyclin-dependent kinases and E2F and histone deacetylases throughout the G1 phase of the cell cycle. In pancreatic…
On or DNA requirements have been incubated with 150 mL of 1 ?PicoGreen reagents and after that utilised for fluorescence measurements at 485/518 nm (excitation/emission). Calcium assay Microbead GFP Protein…
Ted no signs of toxicity as determined by the LDH cytotoxicityTed no indicators of toxicity as determined by the LDH cytotoxicity assay (7.five four.9 vs six.0 four.two for handle and…
Nflammatory control tissues. IL-19-producing cells had been located IL-13 Protein Synonyms mostly in mucosaNflammatory control tissues. IL-19-producing cells were found mostly in mucosa, submucosa, adventitia and perivascular inflammatory infiltrates. IL-19…
Ressive functions and poor prognosis of human urothelial carcinoma of yourRessive features and poor prognosis of human urothelial carcinoma of your bladder. BMC Cancer 2013 13:349.Lim et al. BMC Pulmonary…
S in the tamoxifen arm and 47 within the placebo arm; HR =0.48; 95 CI: 0.29 to 0.79).30 The adverse events observed with tamoxifen in the European trials have been…
Cellular 18F-FET were substantially lower than these of 18F-FDG, using aCellular 18F-FET have been significantly decrease than those of 18F-FDG, using a maximum level of 20 cpm1000 cells (Figure 3B).…
Upplied protocol. Blood was also stimulated for 16 h with antiIgD toUpplied protocol. Blood was also stimulated for 16 h with antiIgD to induce BCR-mediated B-cell activation, and after that…
Ll lines with IC50 values of 46.2 and 38.six M, respectively . In 2012, Lin et al. studied the chemical constituents of Rabdosia serra (MAXIM.) HARA, and identified -sitosterol isolated…
The MC_Rack four.4.eight software program interfaced together with the USB-ME64-System (gain 1200; band width ten kHz; Multi Channel Systems). We opted to record at this lower temperature to be able…
Stern blots (A), representative densitometry values (B) and PSMA Protein Species Summary of experiments (C) demonstrating CFTR endocytosis as a function of time. Selective cell surface biotinylation and western blotting…
E brain (40.0 ) died, 1 patient with recurrence inside the gastrointestinal tract diedE brain (40.0 ) died, 1 patient with recurrence inside the gastrointestinal tract died, and 6 of…
Esponses inside the aortic segments from group 2K1C (Figure 8BEsponses in the aortic segments from group 2K1C (Figure 8B), ALSK (Figure 8C), and ALSKL-arg treated rats (Figure 8E), but the…
Ation of the CD45 phosphatase. Boosting reduction capacity in vitro enhances RA T cell function, CD45 phosphatase activity and decreases Lck phosphorylation Incubation with N-acetyl cysteine (NAC) (one hundred lM)…
On at 0.5 Hz: Pre (0.573 ?0.07 s-1 ) vs. 0?0 s (0.15 ?0.06 s-1 ), P = 1.55 ?10-6 ; vs. 30?0 s (0.033 ?0.03 s-1 ), P =…
Ycycline, the additional potent Ca2+ inhibitor Ru360 ought to also defend against cell killing. Consistent with this expectation, Ru360 was hugely cytoprotective after I/R (Fig. 2B). Ru360 was much more…
Novel acquiring and may perhaps reflect pathophysiologic variations between sexes. CHEST 2015; 147(1):188-ManuscriptNovel locating and might reflect pathophysiologic differences amongst sexes. CHEST 2015; 147(1):188-Manuscript received January 31, 2014; revision accepted…
Yntenous orthologs and divided this by the amount of shared orthologs.Yntenous orthologs and divided this by the amount of shared orthologs. The Iplasma genome has the lowest TROP-2 Protein manufacturer…
Om a postmarketing surveillance study.42 Within this publication, high-quality of life was assessed working with the Short Type (SF)-8 Well being Survey, the European Quality of Life Instrument, plus the…
Ered cubic (FCC) metals often take a polyhedral shape ; for that reason, very branched Ag nanostructures are thermodynamically unfavorable. In our earlier research, flower-like silver nanostructures were synthesized employing…
Netics and Genomics 38, 379?90.Write-up ADDENDUMARTICLE ADDENDUMBioengineered four:4, 249?53; July/August 2013; ?2013 Landes MIG/CXCL9 Protein medchemexpress Biosciencepotential of Ophiostoma piceae sterol esterase for biotechnologically pertinent hydrolysis reactionsV tor Barba Cedillo,…
Was extra refined around the nostrils (typical node spacing = 0.three mm aboutWas extra refined around the nostrils (average node spacing = 0.three mm about the nasal openings) when compared…
Ray Culture and AnalysisArrays were sterilised applying an autoclave (121uC, 20 minRay Culture and AnalysisArrays have been sterilised applying an autoclave (121uC, 20 min), then vacuum-filled with sterile PBS containing…
In vesicles isolated in the spent media of endothelial , fibrosarcoma, and melanoma cells . We identified that the expression of MT1-MMP was greater in parental Karpas 299 cells than…
On for postpartum hemorrhageTable two. Comparison of clinical characteristics amongst PAE group and hysterectomy group Characteristic Maternal traits Age (yr) Primiparity Twin pregnancy Preeclampsia Prior Cesarean delivery Neonatal traits Gestational…
All legal disclaimers that apply for the journal pertain.Perez-Leal et al.Pagedegradation. When the cells are exposed to electrophilic or oxidative stressor molecules, the interaction amongst Keap1 and Nrf2 is disrupted…
Us these solutions are not but amenable for highthroughput experimentation andUs these strategies usually are not however amenable for highthroughput experimentation and pre-clinical testing. Nonetheless, technological progress within the coming…
Ulin resistance in youth with newly diagnosed type 1 and sort 2 diabetes. Study Style AND Solutions Study population The Search for Diabetes in Youth Study can be a multicenter,…
Nd 215201 (to HSS and GKS); Sciencefund Grant, MOSTI, Malaysia (02-01-04-SF1306) awarded to P-SC; along with the APEX Foundation for Study into Intellectual Disability Restricted to CAH: K-HL was a…
Sed by both HEV and CAP. Aquaporins 1, 7 and 11, which regulate tissue fluid, glycerol and potentially CO2 exchange12, were expressed exclusively (Aqp7 and 11) or much more very…
A donor splicing web-site in intron 7 of OPHN1 in an ItalianA donor splicing website in intron 7 of OPHN1 in an Italian household segregating with ID and cerebellar hypoplasia.…
Hepcidin/HAMP Protein manufacturer Epartment of Neurology and Neurosciences, Rutgers New Jersey Health-related College, NewarkEpartment of Neurology and Neurosciences, Rutgers New Jersey Healthcare School, Newark, NJ 2Rutgers Graduate College of Biomedical…
On. Ultimately, we show that human RTEL1 interacts together with the shelterin protein TRF1, offering a possible recruitment mechanism of RTEL1 to telomeres.dyskeratosis congenitabone marrow failure, but mortality from cancer…
Ion is important in order to receive desirable phenolic constituents. In general, aqueous alcohol (80 methanol and 70 ethanol) would be the most preferred solvents to extract phenolic compounds from…
Lis, Pseudomonas fluorescens Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus warneri, Streptococcus gallolyticus, Streptococcus lutetiensis, Streptococcus minor, Streptococcus suis, Pseudomonas fulva, Penicillium spp., Enterococcus faecalis, Enterococcus faecium, Corynebacterium spp., Aspergillus fumigatus, Actinomyces…
Liquid scintillation cocktail (FilterCount; PerkinElmer), and linked radioactivity was counted working withLiquid scintillation cocktail (FilterCount; PerkinElmer), and associated radioactivity was counted applying a Trilux counter (PerkinElmer). Initial transport rates were…
Ent hypertension, for instance that developed in 2K1C models, hasEnt hypertension, which include that created in 2K1C models, has not been demonstrated. Our prior benefits demonstrated that remedy with L-arginine,…
Creased thrombin generation (Freudenberger et al., 2009). Besides MPA, a different synthetic gestagen, norethisterone acetate (NET-A), is frequently made use of in postmenopausal HRT (Koubovec et al., 2005) collectively with…
Inflammatory cytokines. In addition, IL-10 can be a switch element for IgG1 and IgG3 and for IgA1 and IgA2, which has greater protective effect for mucosa. Furthermore, therapy with mesenchymal…
T (Randox Laboratories, Antrim, Uk), whilst leptin was analyzed making use of a Leptin ELISA kit (R D Systems, Minneapolis, USA). Serum levels of cholesterol, triacylglycerol, HDL cholesterol and LDL…
Redients discovered in medicines that help inside the manufacturing, administration orRedients located in medicines that aid inside the manufacturing, administration or absorption of your drug. They typically possess no Phospholipase…
In a complete neighborhood proteomic dataset reported previously , and 3 areInside a complete neighborhood proteomic dataset reported previously , and three are among the most highly detected proteins of…
Umarol to inhibit NQO1 (Fig. 4a). Cytotoxic responses for dC3 micelles in A549 and NQO1+ H596 cells have been slightly less than noted for -lap alone (in DMSO, Figs. S1a…
He epidermis were counted (Figure 1E, F). The total number of epidermal nerve terminals per 1 mm of epidermis indicated that vpr/RAG1-/- mice had an typical of 62 fewer nerve…
Is no current consensus on the reference genes for qPCR analysis of circulating microRNAs. A current study showed that the selection of reference genes for qPCR evaluation can influence the…
E on ACE inhibitory activity. In accordance with Pripp and co workersE on ACE inhibitory activity. In line with Pripp and co workers, hydrophobicity of C-terminal enhanced the ACE inhibitory…
Tween RA sufferers on stable MTX therapy (MTX) or not gettingTween RA individuals on stable MTX therapy (MTX) or not getting MTX (No MTX). Raw information (block dots) are overlaid…
S by centrifuging at 10000 rpm for 20 min in 4uC. The protein concentration was analyzed by Bradford protein assay (Bio-Rad, USA). The entire protein was separated with 10 SDS-PAGE…
A reduced risk of preterm birth when in comparison to women who didn't follow the diet regime . Furthermore, intake of dried fruits, especially raisins, is associated having a reduced…
L et al. 2006; Shonesy et al. 2012). Due to the fact systemic STZ administration final results in systemic toxicity and pancreatic beta-cell death, evidenced by chronic hyperglycemia (Biessels et…
Can, Turkey. E-mail: orhan_biniciwindowsliveINTRODUCTION Post-dural puncture (PDPH) headache is actually aCan, Turkey. E-mail: orhan_biniciwindowsliveINTRODUCTION Post-dural puncture (PDPH) headache is often a common complication for individuals with neuroaxial anesthesia.1 The International…
S that have highlighted the therapeutic possible of targeting the DAG-PKCeS which have highlighted the therapeutic prospective of targeting the GLUT4 Species DAG-PKCe signaling mechanism in treating hepatic insulin resistance.PNAS…
Le, PA, USA). Anti-F4/80 (clone BM8), anti-CD45 (clone 104) and anti-CD11b (clone M1/70) have been made use of to confirm macrophage purity, and in combination with anti-RON (clone Phage four)…
Then for 22 h to ethylene below precisely the same situations detailed above. Following therapy, the flowering shoots were transferred to a controlled observation area maintained at 20 ?1 ,…
As just lately reported to advertise NLRP3 inflammasome activation, however the purpose of RIG-I was not included in that do the job . Interestingly, in our research HCV RNA didn't…
And this really is likely due to its capability to inhibit BCL-XLAnd that is likely as a result of its ability to inhibit BCL-XL, whose function is essential to GC…
Gh direct cellcell make contact with . These final results recommended a novel pathway by way ofGh direct cellcell get in touch with . These outcomes suggested a novel pathway…
Deletion viruses despite the comparable single-step replication of these viruses. ThisDeletion viruses regardless of the related single-step replication of those viruses. This suggests that pUL51 plays a crucial function in…
Ere available for the deceased kids. Genetic testing also identified the same mutation within the asymptomatic two-year-old daughter (III-3), who was promptly treated with oral nadolol (two mg/kg). Holter monitoring…
Ing TNBCs to chemotherapy. Firstly, inhibition of autophagy was CDK2 Inhibitor MedChemExpress confirmed by observing accumulation of autophagosomes in Hs578t cells treated with CQ (1 M) alone and in combination…
Head region and are of restricted use to understanding how particlesHead area and are of limited use to understanding how particles get in to the nose from a operate environment.…
Lowering cytokine burden, MTX may perhaps influence BCR mediated B-cell activation, andDecreasing cytokine burden, MTX may perhaps influence BCR mediated B-cell activation, and possibly the dependency on Syk for immune…
Serum levels of CoQ10 16 to 54 , mostly as a result of decreasing serum LDL, that is its important transporter . The effects of statins on skeletal muscle with…
Esence of Ca, Cr, Cu, Fe, Mg, Ca, K and Zn in plants (Perma et al., 1993). Elements have already been reported to play significant part as co-factors of various…
Xt investigated the sensitivity of release facilitation to protein kinase C inhibitors. Bisindolylmaleimide, a distinct inhibitor of protein kinase C that prevents ATP binding, had no effect on the facilitatory…
Ered that the numbers of sufferers at intense BMI was smaller sizedEred that the numbers of sufferers at extreme BMI was smaller inside the present study and may well reflect…
Espondence needs to be addressed Enrique Cadenas Pharmacology Pharmaceutical Sciences College ofEspondence should be addressed Enrique Cadenas Pharmacology Pharmaceutical Sciences College of Pharmacy University of Southern California 1985 Zonal Avenue…
Otoxic T lymphocytes (CTL) from melanomas and epithelial cancers.7?2 Applying cDNA microarray technology coupled with laser microdissection, we lately Casein Kinase web identified novel HLAA24-restricted epitope peptides as targets for…
At 65 , and their fluorescent images had been superimposed working with Microarray Scanner at a resolution of 5 with Agilent Function Extraction ten.1 (Agilent Technologies). To define the scale…
Thway by way of cleavage of caspases and activation of pro-apoptotic proteins . For that reason, we investigated irrespective of whether IRAK4 Inhibitor Synonyms NVP-AUY922 could HIV-1 Activator list influence…
Ted diol diesters with 464 carbon atoms, containing as much as three unsaturations.Ted diol diesters with 464 carbon atoms, containing as much as three unsaturations.Data treatmentThe chemical diversity and sex-specificity…
Alls et al.Pagedistribution and dynamics in vivo.3-6 In thisAlls et al.Pagedistribution and dynamics in vivo.3-6 Within this respect, a surrogate molecule with a functional component might be extremely advantageous.NIH-PA Author…
Applies for the data produced accessible in this article, unless otherwise stated.Ramseier et al. BMC Pharmacology and Toxicology (2015) 16:Page 2 ofpublished by the Swiss Regulatory Agency in October 2012…
Uced soon after remedy with erlotinib (A) and cisplatin (B) following Shh knock-down. Cells have been first treated with vehicle (A549M-control) or with particular si-RNA against Shh (A549M-siShh) for 48…
Elberg, Germany) and characterizing 1N104 cells per sample. The graph shows the percentage of annexin V adverse cells 6 SEM of 3 independent experiments. (TIF)Macro S1 Macro made use of…
Outcome (71.4 vs 16.3 ; P .001, determined by use on the Fisher exact testOutcome (71.4 vs 16.3 ; P .001, determined by use with the Fisher exact test). The…
S isolated from peripheral blood and cytogenetic evaluation was performed onS isolated from peripheral blood and cytogenetic evaluation was performed on cultured peripheral blood lymphocytes in the proband by regular…
Tively bound proteins determined by mass spectrometry had been subjected to functional and pathway analysis. Our findings suggest that the targets of compound 106 are involved not just in transcriptional…
Plots show the 25th, 50th (median) and 75th percentiles. The whiskers show main bl-eeding. Suzuki et the 10 to 90th percentiles. al. suggested that patients whose APTT exceeded 60 Atrial…
Can, Turkey. E-mail: orhan_biniciwindowsliveINTRODUCTION Post-dural puncture (PDPH) headache is often aCan, Turkey. E-mail: orhan_biniciwindowsliveINTRODUCTION Post-dural puncture (PDPH) headache can be a popular complication for sufferers with neuroaxial anesthesia.1 The International…
Son of surface coating regimes varied from conditions in top rated panelSon of surface coating regimes varied from conditions in major panel of A FBS-coated substrate (major) and collagen-I-coated substrate…
Ase by six hours, which was then maintained for at the very least 24 hours.Ase by 6 hours, which was then maintained for a minimum of 24 hours. To figure…
On profiles, suggesting that Tet1 functions at least in part via the Sin3A repression complicated (14), as well as the polycomb repressionThe abbreviations made use of are: Tet, Ten-eleven translocation;…
Ompetent state, increasing the proportion of SVs D1 Receptor Inhibitor supplier within the vicinity in the presynaptic membrane plus the subsequent release of Calcium Channel Inhibitor Storage & Stability glutamate.Acknowledgments--We…
Recombinant proteins. Numerous recombinant antigens had been compared in enzyme-linked immunosorbent assaysRecombinant proteins. Quite a few recombinant antigens were compared in enzyme-linked immunosorbent assays by Sarfati et al. (25), and…
Us these approaches are certainly not but amenable for highthroughput experimentation andUs these methods are not yet amenable for highthroughput experimentation and pre-clinical testing. However, technological progress within the coming…
Rown at 37 for 48 h. Isolated colonies in the plate were MC4R review suspended in 100 mL of glucose-salt-biotin (GSB) media containing ammonia chloride (two g), potassium phosphate (0.35…
With either an HIF-1 expression construct or empty vector. pGL-2B was also integrated as a damaging control. Cells were treated with EtOH (vehicle control), LPS (one hundred ng/ml), TSA (500…
PARP7 Inhibitor site Eriments, information evaluation and reviewing the manuscript.Postpartum hemorrhage (PPH) is a substantial bring about of maternal mortality worldwide, accounting for 25 to 30 of all maternal deaths…
The nose. Fig. six permits a visual comparison of the impact ofThe nose. Fig. six makes it possible for a visual comparison of the impact of nose size on important…
Irection of fluid flow was from leading to bottom. C HeatmapsIrection of fluid flow was from best to bottom. C Heatmaps of expression BACE1 Compound indices for DNA, ELF97, and…
Se of unexpected haemorrhagic CYP3 Formulation symptoms and in truth expected no active therapy. In contrast, the tiny quantity of men experiencing post-biopsy infection reported considerable reluctance to seek healthcare…
And GABAA receptors, to regulate cell surface levels or functional properties. Indeed, we give biochemical proof in assistance of compartmental RCAN1/ CaN signaling (Fig. two). Yet another doable explanation is…
Ect cell-TXA2/TP Agonist supplier Biology in mechanistic terms. 2014 The Authors. Published by Elsevier B.V. That is an open access write-up under the CC BY-NC-ND license (creativecommons.org/licenses/by-nc-nd/3.0/).Introduction Carbon monoxide is…
AnDiscussionIn the present study we showed increased vascular inflammation inside theAnDiscussionIn the present study we showed improved vascular inflammation inside the aortic root of adult Marfan mice, which was substantially…
Nergy 2013, 50:42732. Sakakibara M, Wang D, Takahashi R, Takahashi K, Mori SNergy 2013, 50:42732. Sakakibara M, Wang D, Takahashi R, Takahashi K, Mori S: Influence of ultrasound irradiation on…
Olesterol esters. The fatty acyl distribution inside the brain is also distinct from that within the blood stream and peripheral organs. The brain has reasonably tiny linoleic acid (18:2n?) or…
Mino acid normal mixture had been purchased from Pickering (Pickering Laboratories, Inc., CDK5 Inhibitor Gene ID Mountain View, CA, USA). All reagents and chemicals employed were of analytical grade. Proximate…
And thickness with the peeling arm, respectively. is the strain powerAnd thickness on the peeling arm, respectively. will be the strain energy function that embodies the constitutive behavior with the…
Tween RA patients on steady MTX therapy (MTX) or not receivingTween RA individuals on steady MTX therapy (MTX) or not getting MTX (No MTX). Raw information (block dots) are overlaid…
Catalyzes the reaction shown in Figure 1, which is equivalent to that catalyzed by the wellstudied enzyme glutathione reductase. bis--glutamylcystine (-Glu-Cys), which lacks the glycine moiety of glutathione, is usually…
Promoter activity. The luciferase activity of MAT1A was significantly elevated in a dose-dependent manner within the Dextreated cells (Fig. 1D). These final results have been confirmed in other hepatoma cell…
Psulated nucleic acid, nanoparticles (NPs) had been incubated in PBS at 37 and NP-free supernatants had been collected for the analysis of total nucleic acid content material by the absorbance…
Ernally peer reviewed.Copyright 2014 BMJ Publishing Group. All rights reserved. ForErnally peer reviewed.Copyright 2014 BMJ Publishing Group. All rights reserved. For permission to reuse any of this content material pay…
Ior to polymerization. The surface morphology changed withthe addition of ZnOIor to polymerization. The surface morphology changed withthe addition of ZnO nanostructures. This can be well evident from the SEM…
Adhesion house which has a contact angle of 21.0? resulting in a larger electron mobility of 5.52 ?10-3 cm2 V-1s-1. In addition, the P3HT:ICBA and P3HT:PCBM photovoltaic gadgets with all…
Mitochondrial proteins together with TIM23 (an important element of your mitochondrial innerMitochondrial proteins including TIM23 (an critical element of the mitochondrial inner membrane translocase complicated) might be cleaved and inactivated…
Ommercial sources . PTE, CTE, XTL, PME, GCE, TDE (98 , purity) wereOmmercial sources . PTE, CTE, XTL, PME, GCE, TDE (98 , purity) were acquired from Shanghai Tauto Biotech…
Or ERa signaling. Phosphorylation of HPIP on serine 147 by TBK1 promotes GREB1 expression by estrogens. As HPIP binds TBK1, we LPAR1 Antagonist web explored irrespective of whether HPIP is…
As a adverse manage since it has no anti-Xa activity . TheseAs a adverse control as it has no anti-Xa activity . These data clearly demonstrate that NG6S effectively eliminates…
Xes. (JPG)Figure S1 Figure S2 Renal structure and hormone outputXes. (JPG)Figure S1 Figure S2 Renal structure and hormone output isunaffected by maternal eating plan. A,B; representative histological sections (6200, periodic…
Dies suggests advantageous effects of walnut consumption on lipid profile (20). Inside the meta-analysis by Banel et al. (20), walnut-rich dietary interventions drastically decreased total cholesterol by 0.27 mmol/L and…
Ations. Methods The study was prospective and randomly performed on 50 pregnant sufferers who did not have pregnancy complications, had been aged 18 or over, are of ASA I-II group,…
Ic Acid Trans 18:1 Isomers in Milk Fat Dairy Cows Fed Increasing Amounts of Sunflower Oil and also a Continual Level of Fish Oil. J Dairy Sci 2007, 90:3786?801. 60.…
E brain (40.0 ) died, 1 patient with recurrence inside the gastrointestinal tract diedE brain (40.0 ) died, 1 patient with recurrence in the gastrointestinal tract died, and six of…
Irection of fluid flow was from top rated to bottom. C HeatmapsIrection of fluid flow was from leading to bottom. C Heatmaps of expression indices for DNA, ELF97, and ELF97…
Ion); mRNA was extracted and assayed by QPCR.Tissue Culture CytokineIon); mRNA was extracted and assayed by QPCR.Tissue Culture Cytokine MeasurementIL-1b, IL-6, IL-10, and tumor necrosis element (TNF)-a have been measured…
Lations. Variations in breathing pattern (sinusoidal versus continuous inhalation) and rotationLations. Differences in breathing pattern (sinusoidal versus continuous inhalation) and rotation pattern (continuous rotation by means of 80 versus stepwise…
E is considerable evidence of oxidative damage occurring both locally and systemically in RA (two), and so, we recommend that within this atmosphere a decreased CD45 phosphatase activity benefits as…
Interact with various chromatin regulators, which includes Sin3A and NuRD complexes. Furthermore, we showed that Tet1 could also interact together with the O-GlcNAc transferase (Ogt) and be O-GlcNAcylated. Depletion of…
Des and AG490, a distinct inhibitor of JAK2, resulted in down-regulation of Mcl-1 and apoptotic cell death . Comparable benefits had been observed in Figure 6D. Within this study, the…
Ernally peer RelB list reviewed.Copyright 2014 BMJ Publishing Group. All rights reserved. ForErnally peer reviewed.Copyright 2014 BMJ Publishing Group. All rights reserved. For permission to reuse any of this content…
Irection of fluid flow was from major to bottom. C HeatmapsIrection of fluid flow was from leading to bottom. C Heatmaps of IL-6 list expression indices for DNA, ELF97, and…
Ignant B cells. However, we have observed 3 individuals that have recurred with CD19-negative illness . In two instances, the individuals had previously been treated with CD19-directed blinatumomab, which might…
Ns. Having said that, 3 individuals had intractable uterine necrosis, requiring hysterectomy. As described in the final results, uterine necrosis was P2X3 Receptor Agonist web connected with abnormal placentation, including…
Ucus accumulation inside the airways was associated with minimal inflammation and pathology other than L-type calcium channel Activator Purity & Documentation Air-trapping and atelectasis inside the alveolar regions (Figures 4B,…
Ility of such an approach, as we were not only in a positionIlity of such an strategy, as we weren't only able to screen a sizable number of conditions of…
The nose. Fig. six permits a visual comparison with the impact ofThe nose. Fig. 6 permits a visual comparison of the impact of nose size on crucial region. When the…
Mber of surviving BrdU(+)Beneficial Impact of Lithium on neuronal RepairFigure 2. Effect of lithium (Li) on BrdU incorporation following neuronal loss. Animals were offered either lithium carbonate (100 mg/kg, i.p.)…
By in vitro experiments that not just heparin can block P- and L-selection, but additionally the sea-cucumber FucCS. The blocking action of those GAGs impairs the binding of selectins with…
Ack of p110d or its kinase activity severely impairs germinal center (GC) formation inside the spleen after immunization , , , . We tested irrespective of whether this isoform is…
Former occurs involving 6080 min, ahead of a predominately -sheet population is observedFormer happens between 6080 min, ahead of a predominately -sheet population is observed at 6 h (Fig 6A).…
T at 365 nm (UVP; 8 W), the flavin cofactor is stabilized atT at 365 nm (UVP; eight W), the flavin cofactor is stabilized at the FADstate below anaerobic circumstances.…
E values in bold indicate a substantial AMPK Activator Purity & Documentation distinction involving insulin degludecE values in bold indicate a considerable distinction in between insulin degludec and insulin glargine…
By no signifies suggests that these are the sole components, and on thecontrary, host-geminivirus interactions are identified to involve complicated interactive neworks. It is also significant to take into account…
Hypothesis, enzymatic assays were performed with diverse concentrations of your MLLHypothesis, enzymatic assays had been performed with diverse concentrations of your MLL3 SET domain incubated with stoichiometric amounts of Ash2LRbBP5…
Licate. (d) Western blot analysis of POSTN expression in EPC-hTERT- p53R175H-POSTN and EPC-hTERT- p53R175H-neo cell lysates and conditioned media immediately after 24 h treatment with 5-ID (Car, 0.5 mM, 1…
Red with Cont siRNA.lower of LDL cholesterol level in serum. It was not clear why CS- and PAA-coated Topoisomerase Inhibitor Compound lipoplexes did not induce a gene silencing effect. HARE/Stab-2…
Regulation of reaction usage by nutritional states (Figure five). Apart from chemical turnover in enzyme catalyzed reactions, transport processes happen to be probed by real-time observation with endogenous substrates to…
Ystatins inhibited cathepsin-L- and B-like activities in diverse age nodules andYstatins inhibited cathepsin-L- and B-like activities in diverse age nodules and they also inhibited papain and cathepsin-L activity when expressed…
Analysis; J.S.L., W.-K.H., and S.-H.L.Research; J.S.L., W.-K.H., and S.-H.L. analyzed data; and E.N. and S.-H.L. wrote the paper. The ERα Formulation authors declare no conflict of interest.To whom correspondence could…
N (18 genes), Cardiovascular (25 genes) and Immune disease (26 genes).As a way to better comprehend the regulatory network, we constructed a brief framework in the network (Figure 3B). Transcription…
C polymercoated lipoplexes with CS, PGA and poly-aspartic acid (PAA) and examined the biodistribution and gene silencing S1PR3 Agonist site effect inside the liver after intravenous injection into mice. 2.…
The present study. ACS14 one hundred mM caused about 15 decrease in cell viability whereas 30 mM of ACS14 didn't. As a result, about 85 of cells survived at ACS14…
Nd Cardiology (C.M.A., J.M.G.), Division of MedicineNd Cardiology (C.M.A., J.M.G.), Division of Medicine, Brigham and ROCK manufacturer Women's Hospital and Harvard Health-related School, Boston, MA; Massachusetts Veterans Epidemiology and Study…
Car (WT-S and IL-6 KO-S). Body weight and meals intake wereAutomobile (WT-S and IL-6 KO-S). Physique weight and food intake were monitored biweekly for two weeks. Terminally, food was removed…
Sp. NRC-1 merA was cloned into pET46 in frame using a sequence encoding an N-terminal His6 tag. The protein was wellexpressed in several E. coli strains (E. coli BL21(DE3), BL21…
Mise and tolerability in phase I/II clinical trials in MM 8. In this study, we Trk Inhibitor Storage & Stability similarly determine irrespective of whether isoform inhibition of class-I HDAC…
S involving Ser26 therefore have relevance not only for understanding AS involving Ser26 as a result have relevance not just for understanding A assembly, but also for understanding de novo…
Tical for host immune responses to kill the migrating schistosomulum. Therefore, we speculate that despite the fact that lack of AQP4 may play a crucial role in CD4+ T cell…
S which have highlighted the therapeutic possible of targeting the DAG-PKCeS that have highlighted the therapeutic potential of targeting the DAG-PKCe signaling mechanism in treating hepatic BChE list insulin resistance.PNAS…
Eficits are certainly not wellunderstood, though Mn has been shown to target dopaminergic and GABAergic neurons in the basal ganglia and elsewhere (Crooks et al. 2007a,b; Gwiazda et al., 2002;…
Ion (32.21 ?6.5 ), methanol extract (29.32 ?4.5 ) and water fraction (18.06 ?four.six ). In summary, the crude and fractionated extracts of rhizomes of Alpinia pahangensis showed varying antioxidant…
Ffects.26,33 The pmKATP channels might be activated when cytoplasmic ATP is depleted, major to shortening of action prospective and decreased membrane depolarization, consequently reducingCell Death and Diseaseintracellular calcium overload.51 At…
Important location, Anose will be the total location of the nostril openingsEssential area, Anose would be the total location on the nostril openings, Ucritical may be the upstream freestream velocity…
T at 365 nm (UVP; eight W), the flavin cofactor is stabilized atT at 365 nm (UVP; 8 W), the flavin cofactor is stabilized at the FADstate beneath anaerobic circumstances.…
Ecause also cell-specific differences in biological activity for the many ET-CORMs have been observed, ET-CORMs could pave the way towards improvement of cell or tissue precise CO delivery. Even though…
Ct of SLURP-1.5. ConclusionsBoth rSLURP-1 and -2 inhibit production of inflammatory mediators in human enterocytes, colonocytes, T-cells, and macrophages. Combining both rSLURP proteins amplifies the anti-inflammatory effects. The anti-inflammatory EP…
The nose. Fig. six allows a visual comparison with the effect ofThe nose. Fig. six enables a visual comparison in the impact of nose size on important location. Although the…
Itions. J Am Chem Soc 131(2):42627. 28. Partch CL, Clarkson MW, Ozg SItions. J Am Chem Soc 131(two):42627. 28. Partch CL, Clarkson MW, Ozg S, Lee AL, Sancar A (2005)…
Efficacy and effectiveness of raloxifene for preventing or decreasing the danger of subsequent vertebral and/or nonvertebral fractures by improving BMD and minimizing bone turnover in postmenopausal Japanese women with osteoporosis…
Sion Here a key cardiac cell line was examined for its prospective use to screen for cardiac metabolism elated liabilities. These ventricularcells are derived from adult humans, that is crucial…
Biological fluids provides a direct assessment of GAG storage. However, quantitation of total GAG for molecular diagnosis is limited devoid of additional analysis of your type of GAG that accumulates…
BjectsAfter written informed Coccidia Accession consent, 31 adult subjects had been tested (Table 1). Because thisBjectsAfter written informed consent, 31 adult subjects were tested (Table 1). Because this assay is…
Ubation at space temperature, the cells had been disrupted by sonication (2 ?4 min on ice) making use of a Virsonic Sonicator Cell Disruptor 600 (SP Scientific Co.). Insoluble fractions…
Ral DNA sensing molecule. In contrast to its intersection with STING-TBKRal DNA sensing molecule. In contrast to its intersection with STING-TBK1, we have not located a direct effect of NLRC3…
These receptors and modulate c oscillations14,21. The sufferers with all the neuro-psychological issues such as schizophrenia are linked with disruption of c oscillations22,23, reflecting the dysfunction in sensory data processing…
Ing tissue in the course of contraction.32 Certainly, techniques for preparing blood vessels forIng tissue in the course of contraction.32 Indeed, strategies for preparing blood vessels for experimental manipulation ex…
Ccording for the manufacturer's instructions).Cell Seeding DistributionGiven the importanceCcording to the manufacturer's guidelines).Cell Seeding DistributionGiven the importance of initial cell density on mesenchymal stem cell differentiation , we also wanted…
Ow-risk populations . four.7.4. Intervention Studies A meta-analysis of intervention trials which includes 7951 men and women treated with Galectin Compound Omega-3 when compared with 7855 controls found a considerable…
Or RT-PCR employing the RNeasy?Formalin-Fixed, Paraffin-Embedded kit (Qiagen, Valencia, CA, USA) according to the manufacturer's directions.Smooth muscle cell differentiationwere transferred to specimen support grids and had been counterstained with uranyl…
Adipogenesis in CA XII Inhibitor drug 3T3-L1 cells and tremendously decreased the body weight along with the volume of adipose tissue in mice fed a high-fat eating plan. Earlier studies…
Ernally peer reviewed.Copyright 2014 BMJ Publishing Group. All rights reserved. ForErnally peer reviewed.Copyright 2014 BMJ Publishing Group. All rights reserved. For permission to reuse any of this content material go…
S isolated from peripheral blood and cytogenetic evaluation was performed onS isolated from peripheral blood and cytogenetic evaluation was performed on cultured peripheral blood lymphocytes in the proband by typical…
Patient for 20 months without main complications. Just after 1 month of in-house treatment applying every day CLZ 500 mg and clomipramine 75 mg (to treat obsessive compulsive symptoms) and…
Ing to be appreciated.27 By P2Y2 Receptor Agonist Purity & Documentation clustering functional annotation groups with related annotations collectively according to shared gene members, the enrichment score reflects the biological…
Can, Turkey. E-mail: orhan_biniciwindowsliveINTRODUCTION Post-dural puncture (PDPH) β-lactam supplier headache is often aCan, Turkey. E-mail: orhan_biniciwindowsliveINTRODUCTION Post-dural puncture (PDPH) headache is really a common complication for patients with neuroaxial anesthesia.1…
Son of surface coating regimes varied from conditions in top panelSon of surface coating regimes varied from conditions in top panel of A FBS-coated substrate (top) and collagen-I-coated substrate (bottom).…
Are spared. In spite of its therapeutic guarantee, clinical use of -lap is considerably hampered by its low water solubility (0.038mg/mL) and poor pharmacokinetics. Earlier and current formulations making use…
In (volatiles) and accessory (nonvolatiles) olfactory bulbs. This details is processed by the Me and subsequently directed to ventral striatal nuclei (and especially to the mOT) through direct and indirect…
Ranscription from Zp and Rp include things like transforming development aspect (TGF- ), B-cell receptor cross-linking, phorbol esters, butyrate, ionophores, and hypoxia (8, ten, 11). Z is a bZIP transcription…
S isolated from peripheral blood and cytogenetic evaluation was performed onS isolated from peripheral blood and cytogenetic evaluation was performed on cultured peripheral blood lymphocytes from the proband by common…
Risingly, evaluation from the unit cell RGS19 Purity & Documentation solvent content (Matthews coefficient) clearlyRisingly, analysis of your unit cell solvent content (Matthews coefficient) clearly indicated that only one of…
For every sample with 18S ribosomal protein and -actin utilised as endogenous housekeeping controls. Histological Staining Intact MSC spheroids had been retrieved in the alginate hydrogels at day 1, 7,…
Ts and 1,3-benzenedicarboxylic acid, four,four -bis-, tetrakis ester-detected i drastically elevated in cells overexpressing NCX1.4 also as ER Ca2 content. This latter effect was prevented by tetrodotoxin. In addition, either…
Panied by a decreased inside the expression of both c-GCS-HS and c-GCS-LS. GSH-S and c-GT activities were similar in all cell subsets (Fig. 2A ). Rates of GSH efflux had…
Ths duration; underlying medical illness; RIPK1 Compound family members history of peptic ulcer diseaseThs duration; underlying health-related illness; loved ones history of peptic ulcer illness; active smoker and alcohol use.three…
Es (pepsin, trypsin and -chymotrypsin) had been purchased from SigmaAldrich (St. LouisEs (pepsin, trypsin and -chymotrypsin) have been bought from SigmaAldrich (St. Louis, MO, USA).Purification of possible ACE inhibitory peptides…
Eukaemia (six), mammary gland (5), prostate (7), lung (8), head and neck (9), and kidney cancer (ten), as well as correlates with metastatic possible, undifferentiated histological variety and poor clinical…
Es expression of your BMP-2 gene in bone cells . Mundy and colleagues reported enhanced trabecular bone volume in ovariectomised rats provided simvastatin at a daily dose of five?0 mg/kg…
His study was to determine other amino acids side chains lying in close functional proximity to 1 another and to examine their positions with those predicted by our P2X2R structural…
Ernally peer reviewed.Copyright 2014 BMJ Publishing Group. All rights reserved. ForErnally peer reviewed.Copyright 2014 BMJ Publishing Group. All rights reserved. For permission to reuse any of this content check out…
S isolated from peripheral blood and cytogenetic evaluation was performed onS isolated from peripheral blood and cytogenetic evaluation was performed on cultured peripheral blood lymphocytes from the proband by normal…
L; incubated on ice for 1 h; Sigma), deoxycholate (two.eight mg/ml; incubated at 37 for 20 min; Fisher Scientific, Pittsburgh, PA), and DNase (4.5 g/ml; incubated at space temperature for…
Y, this may recommend the association of omentin and lung injury. Also, provided the fact that omentin blocks proinflammatory cytokines TNF, and signaling pathway NFB, it might be protective in…
Omal/stem cells (MSCs) would outcome in a "humanized" sheep HSC niche. MSCs are known to promote HSC engraftment and immune recovery immediately after HSC transplantation, possibly through the provision of…
Oxicities All 20 individuals had been evaluated for security (Table four). The most typicalOxicities All 20 NLRP3 site patients have been evaluated for security (Table four). By far the most…
Od intake in adult rats; this reduced physique weight get wasOd intake in adult rats; this decreased physique weight gain was partially reversed by LV infusions of IL-6 antibody. Whilst…
Tential; the fifth case had taken atorvastatin as the only medication with DILI prospective, for 36 months. In 27 (20.3 ) circumstances, only one particular drug was utilised, such as…
Partmented chambers. As a result, to assess regardless of whether this type of retrograde degeneration also occurs in vitro and identify the time course for when it happens, 6-OHDA was…
Olution. J. Biol. Chem. 2000, 275, 3328?334. 54. Imbert, A.; Eelkema, R.; Jordan, S.; Feiner, H.; Cowin, P. Delta N89 beta-catenin induces precocious development, differentiation, and neoplasia in mammary gland.…
Opulations. We restricted the analyses to all CHSDA counties combined andOpulations. We restricted the analyses to all CHSDA counties combined and to CHSDA counties in each IHS region: Alaska, Pacific…
E values in bold DPP-2 Biological Activity indicate a significant difference between insulin degludecE values in bold indicate a substantial difference amongst insulin degludec and insulin glargine (p \ 0.05)…
Substrate. Significance: ARSK functions in lysosomal degradation, possibly of glycosaminoglycans, and, in all probability, is related using a non-classified lysosomal storage disorder. The human sulfatase family has 17 members, 13…
D receptors at the plasma membrane. In addition to this classical function, pioneering studies around the EGF-R have established almost 20 years ago that receptor endocytosis could also actively manage…
H EGFR TKI-resistant mutation). Contrary to the reality that insertions beyondH EGFR TKI-resistant mutation). Contrary to the fact that insertions beyond the C-helix (beyond Tyr 764) on the EGFR kinase…
S isolated from peripheral blood and cytogenetic evaluation was performed onS isolated from peripheral blood and cytogenetic evaluation was performed on cultured peripheral blood lymphocytes in the proband by normal…
An et al., 2011; Ansboro et al., 2014]. Prior experiments have investigated the effects of poly(lactic-co-glycolic acid) (PLGA), poly(ethylene glycol) (PEG), hyaluronic acid (HA) MPs, or gelatin MPs on chondrogenesis…
Nm. Every titration point recorded was an average of 15 mea-FIGURE 1. Protein sequence alignment of your MarR family of regulators. Alignment of the amino acid sequences of M. tuberculosis…
Arvested and plated in 25-cm2 polystyrene flasks (Falcon Labware) as described above.Determination of GSH and GSSG Components and Approaches B16-F10 and iB16 melanoma cell cultureMurine B16-F10 (ATCC, Rockville, MD) or…
Oxicities All 20 patients had been evaluated for safety (Table 4). Probably the most prevalentOxicities All 20 sufferers were evaluated for safety (Table four). Probably the most widespread toxicities regarded…
The Tumor Procurement Core (TPC) within the Department of Pathology forThe Tumor Procurement Core (TPC) in the Department of Pathology for supplying the HNSCC tumor samples. The authors also thank…
To EPA and DHA . Though ALA may be converted to EPA and DHA, the overall efficiency is low with conversion ranging from 0.01 to 8 in males or up…
Reated animals (K, L) but is absent in hda-1-RNAi treated animals (M, N). A few of the GFP fluorescing cells are marked by arrowheads and arrows (D, E and F…
D glycans in urinary hFSH were intermediate among four.9 in our studyD glycans in urinary hFSH had been intermediate amongst 4.9 in our study and 3.9 in Baenziger's for pituitary…
Dney Ailments (grant no. DK-030066 to B.E.L.). Duality ofDney Diseases (grant no. DK-030066 to B.E.L.). Duality of Interest. No prospective Bcr-Abl Biological Activity conflicts of interest relevant to this article…
Yonic skeletal formation, and Alk2, three and six play both redundant and non-overlapping roles in precise limb elements. Smad4 is needed for mesenchymal condensation and cell survival within the limb…
D untransduced (OFP? myeloid cells isolated in the spleens of each amiR(Tie2) and amiR(Luc) mice (four weeks immediately after HLI induction; n ?9 mice/group). The plots show the dCt imply…
Polactoferrin, apo-LF; MLF, native milk lactoferrin. 1. Introduction Lactoferrin (LF) is anPolactoferrin, apo-LF; MLF, native milk lactoferrin. 1. Introduction Lactoferrin (LF) is an 80-kDa non-heme iron-binding glycoprotein that belongs to…
Ytical or electrophoresis grade. SP-Sepharose, Sephacryl S-200, Bradford Reagent, BSA, DTNBYtical or electrophoresis grade. SP-Sepharose, Sephacryl S-200, Bradford Reagent, BSA, DTNB, PMSF, EDTA, ovomucoid, iodoacetic acid, bestatin, -mercaptoethanol, PMSF, and…
Y J. Carver Chair in Molecular Medicine (J.F.E.). Mass spectrometry evaluation was performed in the Roy J. Carver Charitable Trust upported Carver College of Medicine Proteomics Facility at the University…
E brain (40.0 ) died, 1 patient with recurrence within the gastrointestinal tract diedE brain (40.0 ) died, 1 patient with recurrence inside the gastrointestinal tract died, and 6 of…
The subunit for the AMPK complex (four). Consequently, we asked whether or not CRBN R419X can interact with all the AMPK subunit, and, in that case, whether expression in the…
Taneous Non-Obese Diabetic (NOD) mouse model of autoimmune diabetes and an over-expression of miR29b is observed in mouse and human islet cells following exposure to pro-inflammatory cytokines . Therefore, the…
Ysiologic temperature and have soluble D1 Receptor Inhibitor Storage & Stability degradation merchandise, making them promising candidates for in vivo applications. Each of those Calcium Channel Inhibitor medchemexpress formulations had…
Ths duration; underlying health-related illness; family history of peptic ulcer illnessThs duration; underlying medical illness; family members history of peptic ulcer illness; active smoker and alcohol use.three Inside the case…
The tumor cell lines for the initial time. No synergistic effects have been identified, which can be in contrast to final results observed employing the Chinese folk formula (ten). Applying…
Entation points for the significance of maintaining the wellness of the axonal compartment. While it remains to become seen no matter whether other PD toxin models, including paraquat or rotenone…
Html) . These recommendations could reflect adequate dietary GlyT2 Inhibitor site intake levels for dietary LC-3PUFA. Effective health outcomes attributed to sufficient LC-3PUFA intake besides CVDassociated involve hemostasis , improved…
Oxicities All 20 individuals had been evaluated for safety (Table four). Probably the most typicalOxicities All 20 individuals have been evaluated for safety (Table 4). The most prevalent toxicities deemed…
S isolated from peripheral blood and cytogenetic evaluation was performed onS isolated from peripheral blood and cytogenetic evaluation was performed on cultured peripheral blood lymphocytes from the proband by normal…
Taneous Non-Obese Diabetic (NOD) mouse model of autoNMDA Receptor Activator supplier immune diabetes and an over-expression of miR29b is observed in mouse and human islet cells following exposure to pro-inflammatory…
He pollen tube growth process (de Graaf et al., 2005; Yoon et al., 2006; Deng et al., 2010; Wu et al., 2010). For example, VANGUARD1 (VGD1) encodes a pectin methylesterase…
Ths duration; underlying healthcare illness; family history of peptic ulcer diseaseThs duration; underlying healthcare illness; household history of peptic ulcer illness; active smoker and alcohol use.3 In the case reported…
Dney Illnesses (grant no. DK-030066 to B.E.L.). Duality ofDney Ailments (grant no. DK-030066 to B.E.L.). Duality of Interest. No possible conflicts of interest GlyT2 Compound relevant to this short article…
E recent GTX680 card (1536 cores, 2G memory) this reduces further to about 520 s. The software might be offered in the publication internet internet site.NIH-PA RAD51 Compound Author Manuscript…
Ry activity in natural product extracts and commonality of extracts that inhibit Pth1 from various bacterial species solidifies this assertion and additional supports the possibility of broad spectrum inhibition. On…
Se expression persists as a consequence of genetic mutation, and lactose tolerance is maintained for the duration of adult life, enabling the use of lactose-containing dairy goods(four). Galectin-9 (Gal-9) belongs…
E brain (40.0 ) died, 1 patient with recurrence inside the gastrointestinal tract diedE brain (40.0 ) died, 1 patient with recurrence inside the gastrointestinal tract died, and 6 of…
S isolated from peripheral blood and cytogenetic evaluation was performed onS isolated from peripheral blood and cytogenetic evaluation was performed on cultured peripheral blood lymphocytes from the proband by typical…
On. Ultimately, we show that human RTEL1 interacts together with the shelterin protein TRF1, providing a possible recruitment mechanism of RTEL1 to telomeres.dyskeratosis congenitabone marrow failure, but mortality from cancer…
Plasma; PDGF-AB, platelet derived growth factor-AB; PSGL-1, P-selectin glycoprotein ligand-1; RANTES, regulated on activation normal T-cell expressed and secreted; SGs, sulfated galactans; SFs, sulfated fucans; SPs, sulfated polysaccharides; TGF, transforming…
Tivity to NE in SMA rings subjected to hypoxia for 3 h, whereas inhibition of RyR2-mediated Ca2+ release from the SR by transfection with RyR2 siRNA substantially restored the vasoreactivity…
Lations. Variations in breathing pattern (sinusoidal versus continuous inhalation) and rotationLations. Variations in breathing pattern (sinusoidal versus continuous inhalation) and rotation pattern (continuous rotation via 80 versus stepwise evaluation at…
Upplied protocol. Blood was also stimulated for 16 h with antiIgD toUpplied protocol. Blood was also stimulated for 16 h with antiIgD to induce BCR-mediated B-cell activation, and then stained…
Unteers at the clinical division of PAREXEL International (South Africa) Bloemfontein. A stock remedy of TK900D at a concentration of 95.39 g/ml was prepared by dissolving 1.021 mg of TK900D…
Protocol. Alternatively, we introduced a protection protocol to find out, no D2 Receptor Modulator Source matter whether the agonist and its antagonist occupy the exact same binding sites no less…
Eported in out there medical records. Including a qualitative study enabled in-depth exploration with the difficulties pertinent to how ladies at improved threat make decisions with regards to tamoxifen prevention.…
Seasoned enhanced urinary frequency and burning with urination in comparison to placebo.Experienced improved urinary frequency and burning with urination compared to placebo. This may have contributed to the truth that…
By in vitro experiments that not just heparin can block P- and L-selection, but additionally the sea-cucumber FucCS. The blocking action of those GAGs impairs the binding of selectins with…
Tood as a result of multiple pathophysiologic processes and adjustments that concurrently take place in this patient population, being a consequence of bad liver function. Various of those alterations which…
E brain (40.0 ) died, 1 patient with recurrence inside the gastrointestinal tract diedE brain (40.0 ) died, 1 patient with recurrence within the gastrointestinal tract died, and 6 of…
Ntiersin.orgDecember 2014 | Volume five | Write-up 650 |Petrasca and DohertyV2 T cells BACE2 custom synthesis induce DCNtiersin.orgDecember 2014 | Volume 5 | Report 650 |Petrasca and DohertyV2 T cells…
Cy histograms of open-duration and closed-duration distributions fitted from events detected just before (upper panels) and through (decrease panels) application of TLR1 Biological Activity NOC-18 (300 M; A), NOC-18 plus…
Ion in Mice Fed Saturated Fat, but Has No Direct EffectsIon in Mice Fed Saturated Fat, but Has No Direct Effects on Hepatic Insulin Signaling. To examine the postulated direct…
He Cambodian children were zinc deficient. The distinct associations amongst STH and stunting found in the two KDM4 manufacturer populations might reflect the distinction in predominating STH species. In the…
Xed in ten neutral-buffered formalin, embedded in paraffin, sectioned, and stained with hematoxylin and eosin. H E tissue sections were evaluated and graded in coded fashion by a veterinary pathologist…
Etime is a principal restriction of hyperpolarized NMR probes, the reporter moiety will probably be chosen to supply an atomic website having a hyperpolarization lifetime that's provided that doable. The…
Ast 8 weeks. Irritable Bowel Syndrome (IBS) sufferers. Patients have been chosen as outlined by Rome II criteria : at least 12 weeks, not necessarily consecutive, in the preceding 12…
Mputing L2 error norms for each degree of PDE2 web freedom among successivelyMputing L2 error norms for every degree of freedom amongst successively smaller sized GSE values inside a provided…
Ion and is subsequently stored in cytoplasmic lipid droplets, which areIon and is subsequently stored in cytoplasmic lipid droplets, that are catalyzed by acyl coenzyme A:cholesterol acyltransferase-1 (ACAT-1)two in macrophages…
T, U.; Howard, B.V.; Resnick, H.E. Dietary calcium is associated with body mass index and physique fat in American Indians. J. Nutr. 2007, 137, 1955?960. Tholstrup, T. Dairy products and…
The reliability of these reports is open to question. The obtaining of lesions at postmortem in non-demented people lends help towards the surmise that late onset F-AD is in all…
Ls. Discontinuations as a result of AEs numerically favoured NPH-insulin, but this resultLs. Discontinuations due to AEs numerically favoured NPH-insulin, but this result was not conclusive as a result of…
Ernally peer reviewed.Copyright 2014 BMJ Publishing Group. All MMP-13 list rights reserved. ForErnally peer reviewed.Copyright 2014 BMJ Publishing Group. All rights reserved. For permission to reuse any of this content…
Tween RA patients on steady MTX therapy (MTX) or not receivingTween RA patients on stable MTX therapy (MTX) or not getting MTX (No MTX). Raw information (block dots) are overlaid…
Nd/or lowered survival (Table 1) . New diagnostic techniques are linking previously unidentified bacteria to colon cancer tumors, highlighting an emerging part for bacterially-driven host inflammation and colon cancer risk…
Ties in infant and kid mortality and Nav1.1 Gene ID morbidity have already been regularlyTies in infant and youngster mortality and morbidity happen to be regularly documented, but are poorly…
E, for instance organ preservation for transplantation and hepatic surgery requiring the Pringle maneuver, minocycline and doxycycline might be productive at decreasing injury. While Ru360 also inhibits MCU and protected…
Polactoferrin, apo-LF; MLF, native milk lactoferrin. 1. Introduction Lactoferrin (LF) is anPolactoferrin, apo-LF; MLF, native milk lactoferrin. 1. Introduction Lactoferrin (LF) is definitely an 80-kDa non-heme iron-binding glycoprotein that belongs…
Ois at Urbana-Champaign (Centennial Scholar Award to C.M.R.). M.Ois at Urbana-Champaign (Centennial Scholar Award to C.M.R.). M.D.B. is definitely an HHMI Early Profession Scientist. M.C.C. is definitely an American Heart…
N et al., 2002). Uridine modified tRNAs have an enhanced capability to "wobble" and study G-ending codons, forming a functionally redundant decoding technique (Johansson et al., 2008). Nonetheless, only a…
Monosomy of MMU12 following partial translocation of MMU16 onto this site. An 2 MB segment from the telomeric finish of MMU12 is deleted , and consequently seven genes had been…
Dition to wild-type Mecp2, we replaced the endogenous gene with two widespread RTT mutations16: a Glyoxalase (GLO) web single in the NID (MeCP2R306C) and a single within the MBD (MeCP2T158M).…
Ed: 01 SeptemberHeat shock proteins: uphill-downhill exercisestress that various forms of exercise can cause; and b) lack of literature data regarding the impact of different varieties of muscle contractions in…
H 1965 and these with any danger indication would increase on capturing HCV-infected persons within the population that are not aware of their infection. There had been numerous limitations to…
Ir of broken DNA employing this uncommon bent structure (5, 29). Presently, itIr of broken DNA working with this uncommon bent structure (5, 29). Presently, it is actually not known…
Itions. J Am Chem Soc 131(two):42627. 28. Partch CL, Clarkson MW, Ozg SItions. J Am Chem Soc 131(2):42627. 28. Partch CL, Clarkson MW, Ozg S, Lee AL, Sancar A (2005)…
Ed a decrease in mucus layer in Cd-treated mice.Statistical analysisValues are expressed as the mean six SD of triplicates. Statistical evaluation was analyzed applying one-way ANOVA. Statistical significance was considered…
With great yield and high enantioselectivity for any assortment of substrates. The stereocenter introduced inside a catalytic, asymmetric style is then utilised to manage diastereoselectivity within a subsequent hydrogenation to…
Cent study has shown that erlotinib can activate AMPK and inhibit mTOR in small cell lung cancer cells with activating EGFR mutations (40), although the mechanism by which EGFR inhibits…
Ths PAK6 Formulation duration; underlying healthcare illness; family members history of peptic ulcer diseaseThs duration; underlying healthcare illness; household history of peptic ulcer illness; active smoker and alcohol use.3 In…
Itions. J Am Chem Soc 131(2):42627. 28. Partch CL, Clarkson MW, Ozg SItions. J Am Chem Soc 131(two):42627. 28. Partch CL, Clarkson MW, Ozg S, Lee AL, Sancar A (2005)…
Rcentage DSB-induced marker loss of Ch16 RMGAH in wild-type (TH2130), rad26 (TH3410), crb2 (TH3383) and OPcdc25 (TH3395) backgrounds. (B) The DNA replication checkpoint will not suppress break-induced LOH. Percentage DSB-induced…
Nd a shape-based preliminary docking. The suitable docking poses were then optionally minimizedEvidence-Based Complementary and Option Medicine0.25 0.20 0.15 0.ten 0.05 0.00 0.30 0.25 0.twenty 0.15 0.10 0.05 0.00 -902…
Ournal.pone.0106408.ginterquartile range (two quartiles) was produced equivalent to 1.35 x SDOurnal.pone.0106408.ginterquartile variety (2 quartiles) was created equivalent to 1.35 x SD plus a complete variety was converted to an SD…
Re isolated more than a ficoll cushion and stored frozen.19 Cells have beenRe isolated more than a ficoll cushion and stored frozen.19 Cells were thawed, blocked for Fc receptors and…
Hages to stimulate EC tube formation. Within a comparable study, each lal+/+ and lal-/- CD4+ T cells showed no effect on EC tube formation (Figure 5B). Inside the in vivo…
Ional Resource Center, a NCRR-NIH funded strain repository, and were donated towards the MMRRC by the NINDS funded GENSAT BAC transgenic project. B6;129S6-Pclotm2Sud/J mice have been bought from Jackson Laboratory.…
Ultiple stressors such as elevated HIV-1 Inhibitor review household transitions, unresponsive caregiving, neighborhood violence, and lack of social help (Evans, 2004). The function and structure with the brain may be…
Mputing L2 error norms for each degree of freedom among successivelyMputing L2 error norms for each and every degree of freedom between successively smaller GSE values within a given mesh,…
Urer's protocol, and extracts had been frozen in aliquots till timeUrer's protocol, and extracts had been frozen in aliquots till time of assay. two.four Growth Element Assays Concentrations of basic…
Lation and artificial vagina . Nevertheless, high proportion of ejaculates obtained via rectal massage represented a sperm-rich fraction with minimal seminal plasma contribution and might not represent a `true ejaculate'.…
Ition with a 50-fold excess of cold B or AP-1oligonucleotide.Invasion assayMatrigel invasion assay was performed as described previously (34).Statistical analysisStatistical data evaluation was performed applying ANOVA. Differences with a P…
By various components from the mitogen-activated protein kinase / extracellular signal regulated kinase (ERK1/2) pathway in a variety of cancer cell forms. Interestingly, whereas RAS will not alter the expression…
E brain (40.0 ) died, 1 patient with recurrence within the gastrointestinal tract diedE brain (40.0 ) died, 1 patient with recurrence in the gastrointestinal tract died, and 6 of…
Es (pepsin, trypsin and -chymotrypsin) had been bought from SigmaAldrich (St. LouisEs (pepsin, trypsin and -chymotrypsin) have been purchased from SigmaAldrich (St. Louis, MO, USA).Purification of possible ACE inhibitory peptides…
Presence of urothelium, the contractile responses of isolated urinary bladder strips in distinctive species in response to numerous stimulators were smaller sized compared with urothelium-denuded bladder strips . The smaller…
Ntial oil. A complete level of ten.six and 36.61 constituents were obtained as monoterpenes and oxygenated monoterpenes. The amount of sesquiterpene hydrocarbons (3.58 ) was very low in comparison with…
Mputing L2 error norms for every single degree of freedom between successivelyMputing L2 error norms for every single degree of freedom amongst successively smaller sized GSE values within a offered…
Ion by T cells (Figures 5C,D; Figure S5 in SupplementaryIon by T cells (Figures 5C,D; Figure S5 in Supplementary Material).ALLOGENEIC AND AUTOLOGOUS V2 T CELLS EQUALLY ACTIVATE DC AND B…
Ave the weakest possible in triggering an acute MH crisis. The data show that nearly all confirmed MH episodes have been triggered by a combination of volatile anesthetics and SCh…
Therogenic genes in macrophages. To proteins with the addition of mannose residues that raise the understand the mechanisms of action of 2C7 scFv on RAW mac- recombinant protein molecular weight.25,26…
Ernally peer reviewed.Copyright 2014 BMJ Publishing Group. All rights reserved. ForErnally peer reviewed.Copyright 2014 BMJ Publishing Group. All rights reserved. For permission to reuse any of this content stop by…
Tween RA patients on steady MTX therapy (MTX) or not receivingTween RA individuals on steady MTX therapy (MTX) or not receiving MTX (No MTX). Raw data (block dots) are overlaid…
And non parasitized red blood cells, and depressed and ineffective erythropoiesis (Weatherall et al., 2002). The present study, observes a important reduction within the haemoglobin level in individuals infected with…
D right here (Table 1). Our findings imply that a combination of hydrophobic/aromatic PPAR Agonist web interactions with electrostatic and hydrogen bonds is necessary for sequestering b2m fibrillar aggregates by…
Enic medium alone on day 7, but MPCs treated with IWP-4 expressedEnic medium alone on day 7, but MPCs treated with IWP-4 expressed elevated levels of DKK1 and GSK3B on…
Wee1 Purity & Documentation Elated to memory immune cells) versus a Topoisomerase Gene ID nonspecific immune response. Therefore, our data do not rule out a nonspecific immune response (probably age…
And RbBP5. Ash2L and RbBP5 carbon atoms are highlighted in light green and yellow, respectively. Crucial hydrogen bonds are rendered as red dashed lines. For clarity, only a subset of…
Esent the implies SEM of replicates within individual experiments.NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author ManuscriptSupplementary MaterialRefer to Web version on D2 Receptor Inhibitor web PubMed IDO Inhibitor Storage…
L circumstances, we hypothesize that this context-dependent distinction in mutant ERRL situations, we hypothesize that this context-dependent distinction in mutant ERR activity might be resulting from a distinction in either…
Ave (ventral) side of the spermatid heads in late stage VIIAve (ventral) side of your spermatid heads in late stage VII and early VIII, to be co-localized with p-FAK-Tyr407 (Figures…
Heteromeric complexes of sort I and form II transmembrane serine/threonine kinase BMP receptors . Signal transduction is mediated by 4 type I receptors (ALK2 , ALK3 , ALK6 , and…
Very confident identification were regarded as to possess a Cn score three.0 and Cn 0.two. All round, this dataset had an typical Cn = 3.536 and Cn = 0.324. Also,…
Opolymers with unique degrees of PME grafting had been ready by varyingOpolymers with diverse degrees of PME grafting have been prepared by varying the molar ratio of the glutamic acid…
Ation rate for each and every bin, we fail to seek out a significantAtion price for every bin, we fail to locate a substantial correlation in μ Opioid Receptor/MOR Purity…
S of your identical or preceding residues. The experiments are eitherS on the identical or preceding residues. The experiments are either carried out with same dwell time for 13C (t1)…
Ctively. The alterations in lactate in response to these compounds support this conclusion. The following experiments had been developed to additional straight define the effects of the compounds on their…
The "synthetic" scFv, misfolding may occur and lead to greater host toxicity issues, therefore decreasing expression levels. The cause why codon-usage optimization a minimum of in aspect, counteracts such an…
Lood glucose levels of ad lib fed db/db mice measured involving ZT0 and ZT3 ahead of each day lipids injections . i. Model for the function of PPAR-PC(18:0/18:1)-PPAR signaling in…
Any methods . In terms of axonal impairment, 6-OHDA and MPP+ eachAny techniques . With regards to axonal impairment, 6-OHDA and MPP+ each bring about the loss of neurites before…
Itation: Cell Death and Illness (2013) 4, e786; doi:ten.1038/cddis.2013.327 2013 Macmillan Publishers RestrictedItation: Cell Death and Disease (2013) 4, e786; doi:ten.1038/cddis.2013.327 2013 Macmillan Publishers Restricted All rights reserved 2041-4889/nature.com/cddisSerum amyloid…
Veness (Smith et al., 2004; Matsumoto et al., 2001). By this polysensory input, the intralaminar thala-mus is in a position to detect diverse behaviorally relevant events. The topographically ordered input…
Paration of ester co-drugs was not as simple as anticipated as a result of reactivity from the C-10 methylene group in 1. Despite the fact that the majority of reported…
Uestions (transmission routes of EVD, appropriate mixing of 0.five bleach). The percentageUestions (transmission routes of EVD, appropriate mixing of 0.five bleach). The percentage of appropriate PDE6 Compound answers rose by…
Handle peptide (IgG2a isotype manage monoclonal antibody). Similarly, the graphsManage peptide (IgG2a isotype handle monoclonal antibody). Similarly, the graphs around the ideal depict the cytokine levels in monocyte cultures derived…
Unsubsidized private insurance, and Medicare. In addition, the percentageof girls who had Pap smear testing at advised intervals enhanced 5 amongst women covered below the Wellness Safety Net. A trend…
E reduction a first-line decision in chiral synthesis. Recombinant strains (commonly engineered Escherichia coli) would be the common sources of synthetically valuable dehydrogenases. This makes it possible for the enzymes…
N to restore the number of neurites and considerably augment their processes length. It is recognized that extensively phosphorylated tau protein types pathologic inclusions containing fibrillar aggregates were found inside…
With ER+ breast cancer who relapse within five years of TAM therapyWith ER+ breast cancer who relapse within 5 years of TAM remedy . Using the KM plotter tool to…
Rejected it in the constituent list (Table 1) based on the lowRejected it from the constituent list (Table 1) depending on the low score. Aside from proteins that bear homologies…
S on a MIL-STD-150A resolution test pattern (Thorlabs, Newton, NJ). For rings of HEK293s, photos were taken on a daily basis for four days, even though for rings of SMCs,…
Dioprotective effects of autophagy inducing drug, chloramphenicol113, 114. Within the rat myocardial infarction model, blocking autophagy by use of bafilomycin led to exacerbated cardiac dysfunction115. In another study, glucose deprivation…
S; white arrow indicates the P3a (positive, red) central-scalp distribution]. Source evaluation, again, implicated the STG and frontal areas (IFG and SFG in humans and RG and ACG in NHPs)…
Ed inside the preparation of phospho-ERK were generous gifts from Dr.Ed inside the preparation of phospho-ERK have been generous gifts from Dr. Lefkowitz at Duke University, U.S.A. The nerve growth…
Ulin na e) HbA1c, imply ( ) FPG, mean (mmol/L) PPPGUlin na e) HbA1c, mean ( ) FPG, imply (mmol/L) PPPG, mean (mmol/L) Glycaemic handle (5-LOX MedChemExpress insulin customers) HbA1c,…
Ins. The P-cluster atmosphere was remarkably diverse, having a limited number of ATR web conserved residues besides the metal ligands. In contrast, the cofactor pocket was highly conserved with small…
Ll transplantationse e on ibl sp elig re d te an ua eq wn Ad kno r no DoInadequate response Transplantation unclear (Donor unknown; patient might or might not be…
This plasmid also encodes the enhanced green fluorescent protein (EGFP), whichThis plasmid also encodes the enhanced green fluorescent protein (EGFP), that is expressed only when a mammalian cell is transfected…
E seeded on 6-well, 12-well, or one hundred mm plastic tissue culture dishesE seeded on 6-well, 12-well, or one hundred mm plastic tissue culture dishes one day prior to transfection…
Ted with DMSO in the same concentrations applied in the chemicalTed with DMSO at the exact same concentrations used within the chemical groups. The chemicals applied in this study were…
Uent cause of death and secondary brain insults immediately after brain injury . The maintenance of sufficient cerebral perfusion stress (CPP), that is linked with handle of intracranial stress (ICP),…
S-wave (CW) EPR and also the Ka-band (30 GHz) electron spin echo (ESE) field-sweep spectra (Figure 4) are characterized byArticleIn addition, to reduce the dependence on the 14N ENDOR line…
Nt had been diagnosed prenatally as obtaining a duplication of exons 1 in the ATP7A gene. We hypothesized that, when the ATP7A promoter area had not been interrupted by meiotic…
Ther. Author manuscript; readily available in PMC 2014 December 01.Neumann et al.PagemediatedTher. Author manuscript; available in PMC 2014 December 01.Neumann et al.Pagemediated by the degree of GSK3activity. The information from…
Oproteinases mesenchymal stromal/stem cells omental adipose platelet-derived development issue subcutaneousOproteinases mesenchymal stromal/stem cells omental adipose platelet-derived growth issue subcutaneous adipose stromal cell-derived factor-1 tumor-associated fibroblasts transforming development factor-beta Tumor necrosis…
Ds with these of genuine standards. Concentrations of retinol and REs within the tissues have been quantitated by comparing integrated peak regions of each and every retinoid against those of…
Ertions lines for PME17 and SBT3.five. (A) Localization of T-DNA insertions in PME17 (top rated) and SBT3.five (bottom) genomic DNA sequences. Promoter, five -UTR and three -UTR, and exons are…
Ients with adenocarcinoma histology versus 4 patients with squamous cell carcinoma. Mutation status was EGFR Caspase 6 Inhibitor Biological Activity wild-type in seven sufferers, EGFR-mutant in two individuals (exon 19…
Ulfate, and also the followed number stands for the amount of NHUlfate, along with the followed number stands for the volume of NH3H2O added.dominant aspect influencing the ratio of HCP…
S of your identical or preceding residues. The experiments are eitherS from the same or preceding residues. The experiments are either carried out with similar dwell time for 13C (t1)…
Eatures of your material, i.e., on distinctive microstructural components present in the vicinity from the dissection, including collagen and elastin, also as their mechanical properties. When a dissection propagates, it's…
F section. Insets in (K, L) show b-galactosidase staining and eosin counterstaining on serial sections. (T) A operating model for function of tissue sources of Wnt ligands throughout cranial mesenchymal…
St to HS therapy, IFN-c remedy doesn't induce the expression of hsp90a or other associated genes, including CIITA-pIV, in Jurkat cells . Within this study, we demonstrated that p-KDM3A occupied…
Circumstances were also characterized, to assess the robustness of specimen shipmentConditions had been also characterized, to assess the robustness of specimen shipment options. Freeze/thaw stability was crucial to show since…
Attering (SERS) substrates, Raman signal of Rhodamine 6G, or 4-aminothiophenol withAttering (SERS) substrates, Raman signal of Rhodamine 6G, or 4-aminothiophenol with concentration as low as 10-7 M was STAT5 Formulation…
Untreated cells 125 one hundred 75 50 25FWT RIP1-/RIP1 KD/KD RIP1-/-Casp8-/-ETN F+Rip1+/- Casp8+/- intercross Mendelian frequency Genotype ( ) Rip1 Casp8 Rip1 Casp-/-Observed frequency ( ) 13.four 17 0 30.4…
With ER+ breast cancer who relapse inside five years of TAM treatmentWith ER+ breast cancer who relapse within five years of TAM treatment . Making use of the KM plotter…
Ial cells with the resident vascular network structures and any web-site appropriate epithelial cell populations. The remaining vascular network, devoid of endothelial cells, has been proposed as a possible guide…
Rstand the differential effects of flumatinib around the kinase β-lactam Chemical manufacturer activation of imatinib-resistant KIT double mutants, a molecular model was constructed from the coordinates on the crystal structure…
17 immune responses are essential for host defence in intracellular pathogen clearance17 immune responses are necessary for host defence in intracellular pathogen clearance and mucosal antimicrobial immunity, respectively, uncontrolledAbbreviations: FOXP3,…
Diates by the induced enzymes , though the amount of susceptibility could possibly vary dependent upon the activity of other phase I too as phase II enzymes. NAT25 (rs1801280) and…
Ve of their related which means. Initially, the time connected with anVe of their linked meaning. Initial, the time associated with an extracted function contour was normalized for the variety…
Adt (Duke University) (42). Neurite analysis. Neurites were measured from phase-contrast images taken having a Nikon inverted microscope at 0 magnification applying the NIH ImageJ plug-in NeuronJ (65). 3 pictures…
Werful tool for 13C-13/12C bondmer analysis in comparison with traditional procedures. Signal splitting from 1JCC in 1D-13C NMR have been conventionally employed for 13C-13/12C bondmer analyses for the studies on…
Egradability and lack of toxicity (Carlsen and Lecommandoux, 2009, Lavasanifar et al.Egradability and lack of toxicity (Carlsen and Lecommandoux, 2009, Lavasanifar et al., 2002, Li, 2002). OPAXIOTM, a poly-L-glutamate-paclitaxel conjugate,…
Ulation of Treg (data not shown). Intracellular Gal-9 production was alsoUlation of Treg (data not shown). Intracellular Gal-9 production was also detected in enriched human Treg, i.e. CD4�CD25�CD1272 soon after…
Ine signal (F0). Gaussian noise was superimposed to resemble intrinsicSuper-Resolution ModelingIne signal (F0). Gaussian noise was superimposed to resemble intrinsicSuper-Resolution Modeling of Calcium Release within the Heart photon noise. Spark…
Ype I IFN STING Inhibitor manufacturer pathway Is Considerably Up-regulated in ErbB3/HER3 supplier D6-deficient Mice--To supply additional support to the hypothesis that the kind I IFN pathway was drastically up-regulated…
He waters in the Indian rivers Ganga and Yamuna contained a biological principle that destroyed cultures of cholera-inducing bacteria. This substance could pass via millipore filters, recognized to become in…
Tree, different genotypes and subtypes are distinct, connected lineages are inTree, distinct genotypes and subtypes are distinct, connected lineages are in proximity, and isolates of the exact same subtypes kind…
Presentation of connected peptides of distinct length and conformation, homologous to self-peptides with high flexibility in their bound state. In conclusion, the higher accuracy and sensitivity of present MS technologies…
And what it will not. Expert Opin Pharmacother 2012, 13(11):1599613. 28. Voruganti L, Awad G: Individual evaluation of transitions in treatment (PETIT) a scale to measure subjective elements of antipsychotic…
Nce) supplemented with ten fetal calf serum (FCS) and 2 mM L-glutamine. RAWNce) supplemented with ten fetal calf serum (FCS) and two mM L-glutamine. RAW cells were plated at 336103…
Oxic drug291, and sodium dodecyl sulfate (SDS), a detergent commonly utilized to denature proteins for electrophoresis, and as a good manage for toxicity testing32. Measurements in the mobile device-based image…
Lable at Carcinogenesis On-line). This latter observation may perhaps account in element for the relative resistance of SW480 cells to DAPM remedy. p21-null colon cancer cells are resistant to cell…
Survivorship. In conclusion, breast cancer survivors with reduce social help priorSurvivorship. In conclusion, breast cancer survivors with reduced social support prior to remedy experienced higher levels of pain and depressive…
Sulfate conjugates of monohydroxy-cholenoates (m/z 453) and MMP-9 drug dihydroxy cholanoates (m/zSulfate conjugates of monohydroxy-cholenoates (m/z 453) and dihydroxy cholanoates (m/z 471) were observed. Ions of lower abundance were generally…
S with the exact same or preceding residues. The experiments are eitherS from the very same or preceding residues. The experiments are either carried out with exact same dwell time…
N of bladder tumor; TMA: Tissue microarray; H E: Hematoxylin and eosin; EDTA: Ethylene-diamine tetraacetic acid; DAB: three,αLβ2 web 3-diaminobenzidine; LI: Labeling index. Competing interests The authors declare that they…
H controls in spite of numerous adjustments in concentrations of 13C-labeled metabolites downstream of glucose.5 The increased level and 13Clabeling of lactate in McGill-R-Thy1-APP rats within the present study reached…
(B) Bar graph of the COX-2 Activator custom synthesis phenotype of gt slpr mutant cuticles(B) Bar graph of your phenotype of gt slpr mutant cuticles recovered amongst progeny from the…
Lasmid pJMB202 was transduced into AH1263, and TRPML Gene ID single colonies had been made use ofLasmid pJMB202 was transduced into AH1263, and single colonies have been utilized to inoculate…
Estinal smooth muscle improvement employing a novel sm22alpha-b promoter. Dev.Estinal smooth muscle improvement using a novel sm22alpha-b promoter. Dev. Dyn. 239, 2806812 (2010). 51. Pietsch, J. et al. lessen encodes…
S in Prh LTD and LTP This figure summarizes the function of NO and endocannabinoid signalling in Prh long-term synaptic plasticity. Each CCh-LTD and five Hz LFS-LTD are blocked by…
Function and protects against accelerated atherosclerosis and kidney injury , but the underlying mechanisms are unknown. In this study, we provide evidence that UA protects blood monocytes from metabolic μ…
N fractional components of chloride transport we've observed inside the rectal mucosa of mice parallels what we have previously reported for the nasal mucosa . The truth that the response…
96), around the basis of the closer similarity with the encoded protein96), around the basis in the closer similarity of the encoded protein to KtrC than towards the second homologue,…
Eling on the dye makes it an ideal platform for largescaleEling with the dye tends to make it a perfect platform for largescale genetic or chemical screening. Via careful dissection…
Y image of NIH-3T3 cell F-actin Indoleamine 2,3-Dioxygenase (IDO) Synonyms arrangement. NIH-3T3 cells have been left untreated (control), cultured in serum-free medium for 24 hr (serum starved), cultured in serum-free…
E initial immunization. Sera have been collected weekly through the vena cava. Values are expressed as imply absorbance values common error. p 0.05 (compared with pBudCE4.1 or PBS).A RECOMBINANT PLASMID…
Se was confirmed to become slow, the maximal drop in contractionSe was confirmed to become slow, the maximal drop in contraction frequency occurring at four min following commencing the two…
, which encodes a putative lytic transglycolase and was induced 21.4-fold by, which encodes a putative lytic transglycolase and was induced 21.4-fold by two M NaCl in this study. SceD…
Ulation of Treg (information not shown). DNA Methyltransferase medchemexpress Intracellular Gal-9 production was alsoUlation of Treg (data not shown). Intracellular Gal-9 production was also GLUT4 manufacturer detected in enriched human…
Ajority of research with aP vaccine describe a mixed Th1/Th2 or Th2-predominant response (two, 12, 16, 18, 20), some studies document a Th1-predominant response (21, 22). Furthermore, you can find…
Er alone or with 0.5 mg/ml TCE for four, ten, 16, 22, 28, 34 or 40 weeks. TCE exposure didn't alter the number of PEC recovered at any on the…
O-dissection of crown CXCR4 Inhibitor list nodule tissue, and not micro-dissection with chosen tissues, RNAseq information represented transcription profiles on the complete nodule and also contained transcripts from locations surrounding…
With ER+ breast cancer who relapse inside 5 years of TAM therapyWith ER+ breast cancer who relapse within five years of TAM remedy . Using the KM plotter tool to…
Heir biogenesis (61) also as serving as informative indicators for theirHeir biogenesis (61) too as serving as informative indicators for their lipid composition (62). In Drosophila, the two perilipin homologues…
Anidins have shown potent -glucosidase inhibitory activity(36,37). The anthocyanins inside the bilberry extract are properly documented(38,39) and consist of both cyanidin-3-galactoside and proanthocyanidins. As the glucose load Polycal made use…
Ent and therefore not detected at the 1-h time point, that ubiquitylated proteins had been quickly degraded, or that the degradation of these proteins is linked with deubiquitylation. Furthermore, noted…
D-type photolyase, the ultrafast cyclic ET dynamics determines that FADcannot be the functional state although it may donate one electron. The ultrafast back ET dynamics with the intervening Ade moiety…
Levels (Fig. 2B), as does co-transfection with wild sort ERK2 (FigLevels (Fig. 2B), as does co-transfection with wild variety ERK2 (Fig 2C). StimulatingNIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author…
Estinal smooth muscle development using a novel sm22alpha-b promoter. Dev.Estinal smooth muscle improvement utilizing a novel sm22alpha-b promoter. Dev. Dyn. 239, 2806812 (2010). 51. Pietsch, J. et al. lessen encodes…
96), around the basis on the closer similarity of the encoded protein96), on the basis of the closer similarity of the encoded protein to KtrC than towards the second homologue,…
Initial cultured in LB broth in 20 mm test tubes with shaking (250 rpm) inside a water bath (New Brunkswick Scientific). Just after 5 6 hrs of development, they were…
Ila Smith and R. montanensis isolate M5/6 have been propagated in an African green monkeyPLOS A single | plosone.orgCharacterization of Tick Arp2/3 Complexfrom 75 ng of DNase-treated total RNA making…
Ks (eight doses) of treatment applying the IVIS imaging system. The mice had been euthanized 48 hours immediately after the final injection, and primary tumors have been excised and weighed.…
Estinal smooth muscle improvement using a novel sm22alpha-b promoter. Dev.Estinal smooth muscle development making use of a novel sm22alpha-b promoter. Dev. Dyn. 239, 2806812 (2010). 51. Pietsch, J. et al.…
Concentrations KLF Formulation compared with that within the sham group (P,0.05). The vascular response to NE in the shock+drainage group + was significantly greater than that from the shock group…
S (28). Utilizing the Glide universal decoys, only 14.four of decoys have been predicted as hits. This is an encouraging indicator, specifically through VS with unfocussed ligand library. The early…
Y as well as the other in south-eastern Asia have noted Hb lowerY along with the other in south-eastern Asia have noted Hb lower or mild anaemia amongst malarial situations…
Orted cells. Promoter-Reporter Luciferase Assays MCF7 and SUM44 cells have been seededOrted cells. Promoter-Reporter Luciferase Assays MCF7 and SUM44 cells have been seeded in poly-L-lysine-coated 24- and 12-well plastic tissue…
E human neuronal cell line HTB-11 and key murine neuron culture. Additionally, it has been reported that though anti-Tat antibody couldn't completely block HIV infection, it could suppress HIV replication…
Nce endothelial cells in vitro, because this model is well-established to test common defined reactions of endothelial cells in vitro that might reflect in vivo circumstances. As all aspects showed…
Techniques associated to cell cycle regulation and DNA damage repair (FigureWays related to cell cycle regulation and DNA damage repair (Figure 4A; Table two). In contrast, the same enrichment analysis…
Attering (SERS) substrates, Raman signal of α9β1 site Rhodamine 6G, or 4-aminothiophenol withAttering (SERS) substrates, Raman signal of Rhodamine 6G, or 4-aminothiophenol with concentration as low as 10-7 M was…
Fic primers listed in Table S1 in the supplemental material, using MMLV reverse transcriptase and also the circularized RNA because the template as outlined by the manufacturer's instructions. The cDNA…
Es of TRITC or FITC.The Protein Exchange23-day old female Wistar rat was obtained from the Division of Pathological Anatomy, Wroclaw Healthcare University. The animal was euthanized by decapitation, in accordance…
Ng nasal breathing in comparison to mouth breathing simply because particles with important gravitational settling must modify their path by as a great deal as 150to move upwards into the…
Rowth in two M NaCl leads to clarification of physiological roles forRowth in 2 M NaCl results in clarification of physiological roles for Kdp and Ktr K uptake systems. mBio…
, along with the MRM analyses with constant Bax Activator Formulation recovery of proteins in technical, as well as the MRM analyses with consistent recovery of proteins in technical replicates.…
Iple MyelomaFigure three. Uptake of 11C-MET and 18F-FET by MM-cell lines in comparison to 18F-FDG. Intracellular radioactivity following incubation with 18F-FDG (A), 18F-FET (B) or 11C-MET (C) was quantified applying…
1001 individuals began on insulin detemir OGLD, of which 865 (86.4 ) have been insulin na1001 individuals began on insulin detemir OGLD, of which 865 (86.4 ) have been insulin…
Hil content material with an enzyme marker. J Invest Dermatol 78(three):20609.17004 | pnas.org/cgi/doi/10.1073/pnas.Corridoni et al.Purification and Characterization of a Mycelial Catalase from Scedosporium boydii, a Beneficial Tool for Distinct Antibody…
Mpared to usual diet in unadjusted analyses only, and being on a low fat/cholesterol diet in each unadjusted and adjusted analyses. Outcomes from Multivariable Regression Analyses of Specific Nutrient Tyk2…
And what it does not. Specialist Opin Pharmacother 2012, 13(11):1599613. 28. Voruganti L, Awad G: Private evaluation of transitions in treatment (PETIT) a scale to measure Subjective aspects of antipsychotic…
On in the co-activator PGC1 . Moreover, they state that mapping andOn from the co-activator PGC1 . Furthermore, they state that mapping and mutation on the proposed phosphorylation web-sites in…
Reason for the absence from the signal-depleting extra delay. Also, itReason for the absence from the signal-depleting added delay. Also, it offers easy Pake powder pattern spectra for all web…
Asparagine residue altering it to proline in the 68th (N68P), 73rd (N73P) or 211th (N211P) residue . SW480 or COS7 cells transfected with any in the CETP manufacturer CHI3L1 mutant…
TGG TGG TGG CGC CAG ACA30 . Quantitative realtime PCR (qRTPCR) wasTGG TGG TGG CGC CAG ACA30 . Quantitative realtime PCR (qRTPCR) was performed using a BioRad CFX96 system with…
A different 60 rats (n520 in each and every) have been grouped and treated as talked aboutOne more 60 rats (n520 in each and every) were grouped and treated as…
Ave (ventral) side from the Cathepsin B Compound spermatid heads in late stage VIIAve (ventral) side with the spermatid heads in late stage VII and early VIII, to become co-localized…
E male offspring; 26 were homozygous for the deletion, 48 were heterozygous and 26 have been wild form.PLOS 1 | DOI:ten.1371/journal.pone.0114942 Nav1.3 site December 26,7 /GPR120 Will not be Needed…
Of China; Grant numbers: 31070941, 30770679, 20831006; Grant sponsor: Key State Simple Research Improvement System of China; Grant quantity: 973 Program, No. 2010CB530004 (to W.L.).LITERATURE CITEDAlbin RL, Young AB, Penney…
Ns were hugely knowledgeable with youth with tic disorders and underwent YGTSS rater reliability education, which integrated quite a few practice interviews using education videos created by Lawrence Scahill (Yale…
With ER+ breast cancer who 5-HT6 Receptor Modulator review relapse within five years of TAM therapyWith ER+ breast cancer who relapse inside 5 years of TAM therapy . Applying the…
Java, relapse prices were comparable, with two of 36 (6 ) relapses immediately after treatment withTableJava, relapse prices have been comparable, with 2 of 36 (6 ) relapses after remedy…
So be required for spread (17, 18). The secondary envelopment function of pUL71 is tied to leucine zipper-dependent oligomerization from the protein (51). The leucine zipper motif will not be,…
Tease loved ones. BLASTn, tBLASTx and BLASTp programmes have been applied to identify all I25 cystatins and all C1 cysteine proteases with an E-value cut-off of 1E-1.0 to recognize homologous…
Orted cells. Promoter-Reporter Luciferase Assays MCF7 and SUM44 cells have been seededOrted cells. Promoter-Reporter Luciferase Assays MCF7 and SUM44 cells were seeded in poly-L-lysine-coated 24- and 12-well plastic tissue culture…
Terol-lowering action of plant stanol esters. J Nutr. 1999;129:21092. 7. Heinemann T, AxtmannTerol-lowering action of plant stanol esters. J Nutr. 1999;129:21092. 7. Heinemann T, Axtmann G, von Bergmann K. Comparison…
Hosphotransferase (Step 7) GPI CB1 Inhibitor Species transamidase (Step 8)GPI12 GPI14 GPI18 GPI10 ni GPI13 GAA1 GPI8 GPI16 TTA1 TTA691 aa 462 aa 325 aa 684 aa 387 aa 414…
Orted cells. Promoter-Reporter Luciferase Assays MCF7 and SUM44 cells were seededOrted cells. Promoter-Reporter Luciferase Assays MCF7 and SUM44 cells had been seeded in poly-L-lysine-coated 24- and 12-well plastic tissue culture…
Ulation of Treg (data not shown). Intracellular Gal-9 production was alsoUlation of Treg (information not shown). Intracellular Gal-9 production was also detected in enriched human Treg, i.e. CD4�CD25�CD1272 just after…
He ranges of values obtained. Statistical significance for replication and release experiments, where noted inside the text, was determined by utilizing a Student t test, as implemented in Microsoft Excel.…
Iant.Supplemental Details | NPY Y1 receptor Antagonist Compound sequence alignment of the constructs discussed. The pNBE sequence corresponds to P37967; it containsACKNOWLEDGMENTSWe thank SSG Derrick Robinson for assistance with steady…
F force, whereas when this glucose challenge was paired with hypokalaemiaF force, whereas when this glucose challenge was paired with hypokalaemia (two mM K + ) then the force decreased…
On of kdpDE pMAD plus an insert created for allelic recombinationOn of kdpDE pMAD plus an insert created for allelic recombination and deletion of kdpA pMAD plus an insert created…
Eling on the dye makes it an ideal platform for largescaleEling of the dye makes it an ideal platform for largescale genetic or chemical BRPF3 Compound screening. By means of…
A PP1 regulatory subunit whose cytoplasmic localisation depends upon G-actin binding (Wiezlak et al., 2012) and RNA polymerases II and III for whom actin forms a scaffold for the assembly…
SsaysAmino acid transport in Kainate Receptor Antagonist custom synthesis intact cells was assayed by the usage of -labelled L-citrulline (Perkin Elmer), L-lysine (Perkin Elmer) and -labelled L-histidine (ViTrax) as previously…
Ter prognostic issue in melanoma , colorectal cancer , Merkelimpactjournals/oncotargetcell carcinoma and non-small-cell lung cancer . The discrepancy across distinctive studies may perhaps be because of variations in IHC technique,…
Ional studies had been taken in 49 sufferers, from which 42 have been of adequate top quality for subsequent exon array analysis. For the present substudy, pretreatment blood von Hippel-Lindau…
Ntribute to mitochondrial adaptations to aerobic physical exercise. The mechanism by which dietary D3 Receptor Modulator medchemexpress protein modulates skeletal muscle protein synthesis by means of the mammalian target of…
96), on the basis in the closer similarity on the encoded protein96), on the basis of your closer similarity of the encoded protein to KtrC than to the second homologue,…
N FoxP3-Alexa 488 (BioLegend) and isotype manage IgG1 (BioLegend) following fixationN FoxP3-Alexa 488 (BioLegend) and isotype manage IgG1 (BioLegend) right after fixation and permeabilisation working with the FoxP3 Fix/Perm Kit…
Ues (Pardal and Lopez-Barneo, 2002b). Within this in vitro technique, rat CB glomus cells secrete neurotransmitter when exposed to a glucose-free option (Figures 1A,B) (Garcia-Fernandez et al., 2007). This secretory…
Gel Purified samples of TLR4/MD2, Fel d 1, CD14, ovalbumin and LPS in PBS were utilised were applied at a concentration of 1 mg/ml. A mixture of 1 ..l of…
Eived and developed the experiments: QZ LY HX. Performed the experimentsEived and made the experiments: QZ LY HX. Performed the experiments: QZ HC LY HX. Analyzed the information: QZ HC…
96), around the basis from the closer similarity of your encoded protein96), on the basis on the closer similarity of the encoded protein to KtrC than to the second homologue,…
Roscope below low-power (40 views. From every rat, five sections have been chosen randomly. In every single section, the two thinnest and two thickest components of your trabecular wall had…
S have been exposed for the parasite (P. ramosa) and fitness consequences have been recorded as host reproductive accomplishment, susceptibility to the parasite and within-host reproduction on the parasite.ResultsElemental and…
22. Dupraz, C.; Visscher, P.T.; Baumgartner, L.K.; Reid, R.P.22. Dupraz, C.; Visscher, P.T.; Baumgartner, L.K.; Reid, R.P. Microbe-mineral interactions: Early carbonate precipitation inside a hypersaline lake (Eleuthera Island, Bahamas). Sedimentology…
Neck area were all far more popular HDAC6 Inhibitor drug inside the individuals with recurrence. The false-negative rate of 4.0 is consistent with earlier studies13,14,17 and is defined herein because…
Onse through interaction with STING (Burdette et al., 2011; Jin et al., 2011; Sauer et al., 2011). Nlrc3-/- MEFs produced more IFN- and IL-6 proteins in response to transfected c-di-GMP…
S in the 3R4F reference cigarette (550-g TPM/L). Half the amount of mice within the Sham- and CS-exposed groups had been exposed in WBECs plus the other half in NOECs…
0; Sigma ldrich Inc.). The samples from every single treatment have been cleaned with 0.9 NaCl. The clean samples were homogenized in trichloroacetic acid (1:four, w/v) using a Teflon homogenizer…
he phytochemical study pointed to the presence of bornesitol.Figure 14. Molecular docking poses calculated by GOLD between inositol and maltase-glucoamylase (left; PDB ID: 2QMJ) and -galactosidase (right; PDB ID: 3THC).…
BSNENP (PC90C10P0). Nonetheless, CPT11/SM-loaded LBSNEPs together with the addition of 10 PEO-7000K (PC90C10P10) only resulted within a FRB1 of 85.7 11.five plus a FRB2 of 121.three 16.three , which was…
rug metabolism is the method of altering their molecules chemically immediately after coming into your body . In general, the metabolism of medication decreases their therapeutic results . The majority…
S for the ferroptosis pathway by means of the Fenton reaction and lipidS to the ferroptosis pathway through the Fenton reaction and lipid peroxidation. Oxalate binds to Fe3+ to type…
`compareInteractions' function. Substantial signaling pathways were identified utilizing the `rankNet' function`compareInteractions' function. Significant signaling pathways had been identified using the `rankNet' function depending on the distinction in the PPARγ Inhibitor…
improved BMI, insulin, glucose, insulin resistance, and triglycerides. In contrast, BAT, which has extra mitochondria, will be the key succinate-metabolizing tissue . GPR91deletion in myeloid cells protected mice from obesity…
ered plant extracts have been stored and preserved inside a well-contained plastic box. 2.two. Extraction with the Plant Material Around 500 g dry powder of your plant material was taken…
Than DHEA (El Kihel, 2012). It was even advisable as a drugThan DHEA (El Kihel, 2012). It was even encouraged as a drug preventing Raynaud's syndrome attacks (Kazih nitkova et…
azil for many years, has anti-inflammatory, analgesic and healing actions that enhance or avert injuries, and currently its extract is often found in ointments and gels made by the pharmaceutical…
Insects, but you will discover fewer reports of the function of FtzfInsects, but you'll find fewer reports in the function of Ftzf1 in crustaceans. Presently, it is actually known that…
Rocedure to correlate the 3D molecular structure options using the inhibitoryRocedure to correlate the 3D molecular structure options with the inhibitory potency (pIC50 ) values against IP3 R. Moreover, a…
ulated and 33 downregulated substances (Figures 4A, B, G, H). There have been 151 distinct serum substances between group A and group C, with 113 upregulated and 28 downregulated substances…
There was substantial overlap involving differentially expressed genes in the two sexes using the highest proportion of one of a kind differentially expressed genes found in males (Fig. S6). The…
), allocation ratio was2.11. High-quality control analysis by High-performance thin layer chromatography (HPTLC) finger printing HPTLC was performed on silica gel 60F254, 20 10 cm HPTLC plates (Merck, Germany-#5642), with…
Maintaining genes GAPDH and -Actin had been utilised for normalization in theMaintaining genes GAPDH and -Actin have been used for normalization with the target genes which were previously used for…
Ted probability of BPAR Topo I Inhibitor site occurrence is 11.six (CI95 six.6 ; 16.five ) in the CYP3ATed probability of BPAR occurrence is 11.6 (CI95 six.six ; 16.five )…
50 eight.5759 7.9288 8.6776 eight.7437 eight.2747 8.4381 7.4912 eight.7196 9.7283 9.0893 9.3819 eight.9411 9.8641 8.4647 9.0932 9.8493 8.3010 6.Ibrahim Z et al. / IJPR (2021), 20 (3): 254-2-cyano-3-(2'-fluoro-4'-phenoxy--4-yl)-4-(hydroxymethyl)-Npropylazetidine-1-carboxamide}, was found…
lth Statistics in 2013, 1 in four deaths within the United states of america was resulting from cancer (Siegel et al., 2013). Various anticancer drugs have been effectively created inside…
sults in cell apoptosis. Caspase-3 and Bcl-2 are important proteins that stimulate the HSPA5 web pathway of CYP26 list apoptotic cell death . Within this study, we examined the FKA…
Ward primer sequence (5-3) CGACCAGCGGTACAATCCAT TGGTGGGTCAGC TTCAGCAA TTCGCATGATAGCAGCCAGT GATGTTCTCGGGGATGCGAT TTGTGCAAGAGAGGGCCATT GCCACGACAGGTWard primer sequence (5-3) CGACCAGCGGTACAATCCAT TGGTGGGTCAGC TTCAGCAA TTCGCATGATAGCAGCCAGT GATGTTCTCGGGGATGCGAT TTGTGCAAGAGAGGGCCATT GCCACGACAGGT TTGTTCAG CCC TTGCAGCACAAT TCCCAGAG AGC TGCGATACC TCGAACG TCTCAACAATGGCGGCTGCTTAC GCAAACGCCACAAGAACGAATACG…
Henotype of and LK17 (ideal) pGSCs. (B,C) Mean ( E, nHenotype of and LK17 (proper) pGSCs. (B,C) Mean ( E, n = three) cell quantity (A) and doubling time (B)…
for remaining 4 weeks), or 6 doses of STmaroA. The left is survival (Mantel-Cox log-rank test), the middle is number of polyps per mouse (smaller intestine), and also the ideal…
birth or through the initial year, far more rarely happens later in childhood and even in early adulthood . Simply because of its rarity and considerable clinical variability, the classification…
f feasible as a result of recognized higher incidence of congenital malformations and worse cognitive and behavioral outcomes. Nevertheless, right after greater than 50 years due to the fact its…
Re also regarded as promising targets for browsing drugs through theRe also regarded as promising targets for browsing drugs through the DGIdb database (http://dgidb. genome.wustl/). This database has drug ene…
assays have been performed to confirm the targeting interaction. As shown in Figure 6B, the luciferase activity of your wild-type group that contained FOXO1 precise binding web pages was clearly…
Wth was determined automatically just about every hour by optical density measurement atWth was determined automatically every single hour by optical density measurement at 600 nm (Bioscreen C; Labsystems, Helsinki,…
Pp. Posaconazole is metabolized within the liver via glucuronidation and hasPp. Posaconazole is metabolized in the liver by way of glucuronidation and has drug to drug interactions involving of your…
above) showed no recurrence at as much as 18 months soon after therapy cessation.treating ulcerated hemangiomas. Further studies are for that reason nonetheless necessary to clarify these aspects.three | B…
d absorption of CPT11 preferentially in the stomach should boost its oral systemic bioavailability against tumor cells by escalating the proportion of SN-38 that reaches the tumor in active type.…
them have been enriched in GO and none had been enriched in KEGG. The functions in the genes families that had undergone contraction have been related to genetic information processing,…
European country . four. Final Remarks HBM has contributed to the availability of data related to COX-2 Modulator list exposure to mycotoxins in the Portuguese population. The identified exposure determinants…
n of your manuscript. Funding: This research was funded by Consejer de Educaci de la Comunidad de Madrid, via the Atracci de Talento plan, grant number 2018-T1/BMD-10731. Institutional Review Board…
Dicate induction; bars indicate inhibition; ellipses denote receptors; cylinders denote transportersDicate induction; bars indicate inhibition; ellipses denote receptors; cylinders denote transporters; and broken line boxes denote enzymes.The function of PXR…
The above Topoisomerase MedChemExpress conclusions are consistent using the analysis ALK6 list findings on ArabidopsisThe above conclusions are consistent together with the analysis findings on Arabidopsis thaliana and rice. We…
Ential oil and pulsed iron oxide nanoparticles considerably inhibited the fungalEntial oil and pulsed iron oxide nanoparticles substantially inhibited the fungal adherence of C. albicans and C. tropicalis. In addition,…
tar HIT-IgG immunoassay demonstrated strongly optimistic final results, along with the serotonin release assay confirmed the presence of heparin-induced antibodies that has a consequence of 104 with lower dose 0.1U/mL…
soon after oral and intravenous administration, respectively. FRB UCA DB 100 UCB DA (2)where AUC for any PKCι list LBSNENPs formulation A and the AUC for the same drug in…
files amongst yak lungs at 3 various altitudes identifies core regulatory networks and RNAsThe intersection of comparisons in T1 vs. T2, T1 vs. T3 and T2 vs. T3 represented the…
The wet season. MP type form was dominated by fibres inThe wet season. MP form type was dominated by fibres inside the wet season (87 of 103 samples), although within…
Also merged. Differentially methylated regions (DMR) and comparative analysis. Methylation atAlso merged. Differentially methylated regions (DMR) and comparative analysis. Methylation at CpG web-sites was known as applying Bismark's bismark_methylation_extractor (choices:…
ransferases in all organisms use activated L-type calcium channel Inhibitor MedChemExpress sugars which might be conjugated to mono or diphosphate GSK-3 Inhibitor custom synthesis nucleotides as sugar donor substrates. Just…
ance, endocrine, energy metabolism, digestive program, protein production, cytoplasmic translation, and regulation (Supplementary Materials, Excels S3 and S4). The numbers of contracted gene families in genus CCR1 Purity & Documentation…
0.05). The median central concentrations generated by the AL pharmacokinetic model (such as0.05). The median central concentrations generated by the AL pharmacokinetic model (including CDK19 site parameter uncertainty) were comparable…
Related with NOXA1 . Like NOX2, NOX1 have to kind a heterodimer withAssociated with NOXA1 . Like NOX2, NOX1 should type a heterodimer with p22phox for activation and superoxide production…
eH-D-Tyr-Val-Trp-OBz (11)mainlygenerally on throughout molecular dynamics, plus the binding with all the KOR mainly focuses focuses on hydrogen interactions with namics, along with the binding interactions of amainly on hydrogen…
ngth of 527 bp and an typical GC content material of 55 were obtained from control explants (Table 2). The maximum size of any assembled transcript was 7,366 bp, and…
activate the castor oil, which subsequently triggers the metabolic pathways of ricinoleic acid . Such description of cellular and molecular pathways displays the pharmacological rules of castor oil identified so…
E (and its Supplementary Data files).Received: 22 February 2021; Accepted: eight JulyInternationalE (and its Supplementary Facts files).Received: 22 February 2021; Accepted: 8 JulyInternational Journal ofMolecular SciencesReviewThe Function of Plant Hormones…
N-physiological conformations that avoid the N-type calcium channel Inhibitor Storage & Stability protein from returning to its physiologicalN-physiological conformations that protect against the protein from returning to its physiological state.…
F. Truong Berthoz5; G. en6; S. TzivelekisMillennium Pharmaceuticals, Inc., a Takeda Enterprise, Cambridge,United states; 2YolaRX Consultants, Paris, France; 3Faculty of Pharmacy, Universitde Montr l, Montr l, Canada; 4Rutgers, The State…
l., 2015; Fellous et al., 2019).Author Manuscript Author Manuscript Author Manuscript Author ManuscriptIn vitro studies show temperature sensitive methylation at the A-copy impacts a flounder Nr5a2 binding web-site (Fan et…
ompound application routes for larval zebrafish. Uptake routes which IRAK1 Species predominate throughout exposure Figure 1. Possible compound application routes for larval zebrafish. Uptake routes which predominate during exposure by…
R) genes (Figure five) . Methyl salicylate regulated expression of pathogenesis associated (PRR) genes (Figure five) . Methyl salicylate regulated expression of pathogenesis related (PR) genes (Figure 5) . Methyl…
Ential transcriptional activity. To study the correlation in between methylome and geneEntial transcriptional activity. To study the correlation amongst methylome and gene expression SIK3 Inhibitor medchemexpress levels (Fig. 1e and…
cules 2021, 26, x4767 PEER Review Molecules 2021, 26, FOR Molecules 2021, 26, x FOR PEER REVIEW10 9 of24 of 23 10 ofFigure 7. On the left: P-RMSF, receptor kappa;…
pressB member 1 (ABCB1) on membrane transporter P-gp plays an essential function in donepezil transporters across the BBB and inside the clearance of amyloid (A) peptide associated to APOE, ABCB1…
ects with the maximum dose of your extracts have been similar to the normal drug loperamide (three mg/kg), which attained 78.83 of CXCR6 list transit inhibition in mice. In addition…
To pick up more potential Hub genes, those could happen to beTo choose up more potential Hub genes, those could happen to be missed within the PPI network. The co-expression…
ted state binding continuous plot of (a) CV aTC and (b) CV Cl aTGC at lexi 550 nm.FFbuffer Fmicelle K 1 icelle 1 K 0 1 icellewhere, `Fbuffer' and `Fmicelle'…
75 Estimates are: Vc (L): eight.07 (14)a V2 (L): 13.7 (11.four)a V3 (L): 41.9 (22.9)a Cl1 (L/min/): 1.31 (10.4)a Cl2 (L/min): 1.91 (12.five)a Cl3 (L/min): 0.322 (17.7)a TOF impact on…
ress-related proteins are hugely elevated and strongly correlated with clinical attributes of children with ASD when compared with age-matched handle . Alternatively, a link amongst low thyroid hormone levels in…
Rradiated (p = are drastically various (p = 0.0005 for 56Fe were O andRradiated (p = are considerably diverse (p = 0.0005 for 56Fe had been O and p 0.0001…
Re also regarded as promising targets for browsing drugs via theRe also regarded as promising targets for looking drugs through the DGIdb database (http://dgidb. genome.wustl/). This database has drug ene…
roups: a manage group (phosphate-buffered saline (PBS)) and four groups like i.v. administration of a CPT11 option, oral administration of CPT11 alone in water by an injection in LBSNENPs (PC90C10P0),…
mechanism of action of antiviral response genes. IFNT binds to form I IFN receptors (IFNAR) 1 and 2 and activates the Janus kinase-signal transducer and activator of transcription (JAK/STAT) intracellular…
(47.5 in experiment 1 and 44.9 in experiment 2). Interestingly, there was a slight impact(47.5 in experiment 1 and 44.9 in experiment 2). Interestingly, there was a slight effect, but…
ly imputed genetic information was downloaded in March 2018. Further neighborhood post-imputation high-quality manage was D1 Receptor Inhibitor Storage & Stability performed in every single ethnic group separately to eliminate…
Nanjing, China), according to the manufacturer's suggestions. 2.7. RNA Isolation and Real-Time Quantitative Polymerase Chain Reaction (qRT-PCR) Total RNA from frozen liver tissues was isolated utilizing TRIzol Reagent (TaKaRa, Dalian,…
iversidad Ju ez del Estado de Durango (registration quantity R01423301538X020112). The study was performed below an ethical agreement and maintained individual anonymity; informed consent was obtained from every participant. The…
M alone solubilized in LBSNENP (PC90C10P0), CPT11 solubilized in LBSNENP (PC90C10P0), and CPT11 combined with SM in LBSNENP (PC90C10P0) with two manage groups from the oral administration of a PBS…
For CYP3A5 non-expressers. C0/daily dose mean ratio remained stableFor CYP3A5 non-expressers. C0/daily dose mean ratio remained stable over time no matter CYP3A5 genotype (p = 0.22 and p = 0.81…
activate the AMPK Accession castor oil, which subsequently triggers the metabolic pathways of ricinoleic acid . Such description of cellular and molecular pathways displays the pharmacological rules of castor oil…
Velopment of new therapies for the therapy of neurological and psychiatricVelopment of new therapies for the therapy of neurological and psychiatric problems. To be able to increase drug discovery and…
erated by cooling just after concentration and was mounted on a glass fiber. All measurements have been created on an R-AXIS Rapid diffractometer (Rigaku, Tokyo, Japan) making use of graphite-monochromated…
ation. Profoundly, with the addition of Cremophor EL to three SAA systems as shown in Figure 1(A2 two), irrespective of which ratio was used, all had a droplet size smaller…
Ential oil and pulsed iron oxide nanoparticles substantially inhibited the fungalEntial oil and pulsed iron oxide nanoparticles substantially inhibited the fungal adherence of C. albicans and C. tropicalis. Additionally, exactly…
as given to the animals of the control group (I) as cars and loperamide (three mg/kg; b.w., i.p.) to Group II (positive manage) as a typical antimotility drug. Mice inside…
d by HPLCMS/MS on the rat liver microsomal fraction, incubated with every single compound, respectively. The separation was performed with an Agilent 1100 series liquid chromatograph (Agilent Technologies, Palo Alto,…
n vitro dissolution profiles of CPT11 (40 mg/g) and 4 dual-function inhibitors including BA, SM, GA, and GLA (80 mg/g) from PC90C10P0 performed employing a simulated gastric acid solution with/without…
Stered, or transcriptase translocation inhibitor currently stipulated in regulatory agency guidanceStered, or transcriptase translocation inhibitor presently stipulated in regulatory agency guidance .of HIV-1 (Figure 1A) . (NRTTI) in development for…
hermore, oncolytic bacteria have benefited from auxotrophic modifications, utilizing the distinctive metabolic byproducts of your TME to incorporate multiple levels of selective targeting eliciting multilayered prevention of off-target effects .…
the formation of SN-38 in PLK4 web rabbits following oral administration of CPT11 solubilized in DD water (remedy), nNOS Storage & Stability PC90C10P0 (LBSNENP), PC90C10P10 (LBSNENP/10 PEO), and PC90C10P30 (LBSNENP/…
Of Helsinki and Istanbul. Information Availability Statement: The datasets utilized andOf Helsinki and Istanbul. Data Availability Statement: The datasets employed and analyzed throughout the present study are out there from…
and productive functionality data had been analyzed by ANOVA followed by Student's t test. Gene expression and oxidative pressure information were analyzed by repeat measures for within-group evaluation and standard…
Ession for these agents in detail. Despite the widespread use ofEssion for these agents in detail. Regardless of the widespread use of adjunctive agents, no potential research have compared safety…
te Japan, Tokyo, Japan). 5. Conclusions Consuming ARA and DHA could potentially suppress the oxidative anxiety inside the early stage of renal failure and could in turn suppress the progression…
e applied. Herein, we compared wet resting cells and lyophilized cells of recombinant E. coli regarding P450-catalyzed oxidation and identified out that lyophilized cells are well-appropriate as P450-biocatalysts. E. coli…
And tested for droplet size and PDI. As shown in TableAnd tested for droplet size and PDI. As shown in Table 3, values have been comprised between 18.2 and 352.7…
activate the castor oil, which subsequently triggers the metabolic pathways of ricinoleic acid . Such description of cellular and molecular pathways displays the pharmacological guidelines of castor oil known so…
ne sulforaphane can be a all-natural dietary compound, derived from numerous cruciferous plants, which include broccoli, cabbage, and cauliflower, with potent anticancer activity . Previous placebo-controlled, double-blinded, randomized clinical trial,…
s (79), can minimize cholesterol and fatty acid biosynthesis and atherogenic hyperlipidemia in animal models, suggesting that azathioprine could PKD1 Biological Activity possess a related effect (80). SREBP-1 also reduces…
Inside the summer time, winter, and spring showed a 25 , 18 , and 7 raise ofIn the summer, winter, and spring showed a 25 , 18 , and 7…
(GSK-3) as a druggable target for the human protozoan parasite Leishmania ; and cruzipain enzyme, a sulfated glycoprotein acting as primary cysteine peptidase of Trypanosoma cruzi, playing an important role…
and enhanced maize yield under high-density cultivation conditions . As well as the plant hormones GAs and IAAs, other phytohormones, including BRs and ETH, also modulate plant height. Mutants which…
S. Licensee MDPI, Basel, Switzerland. This article is definitely an open accessS. Licensee MDPI, Basel, Switzerland. This article is definitely an open access short article distributed below the terms and…
ins were evaluated employing the disc diffusion approach. Furthermore, in silico study has been employed utilizing Discovery studio 2020, UCFS Chimera, PyRx autodock vina, and on the net tools. In…
iver illness compared with folks devoid of liver illness: anticoagulants (20.six vs. 33.5 ) and antiplatelets (56.2 vs. 71.1 ). Major non-adherence rates (stopping following 1 prescription) had been greater…
nisms of action of existing therapies utilized in AIRDs. Schematic representation summarizing the important mechanistic pathways affected by each classic and modern day therapies employed to treat AIRDs, such as…
Hways identified within this study are at the moment becoming investigated. In conclusionHways identified in this study are presently becoming investigated. In conclusion, our novel single cell RNA-seq data further…
them had been enriched in GO and none were enriched in KEGG. The functions on the genes households that had undergone contraction have been related to genetic info processing, signal…
BSNENP (PC90C10P0). Even so, CPT11/SM-loaded LBSNEPs with the addition of 10 PEO-7000K (PC90C10P10) only resulted in a FRB1 of 85.7 11.5 along with a FRB2 of 121.three 16.3 , which…
mechanism of action of antiviral response genes. IFNT binds to variety I IFN receptors (IFNAR) 1 and 2 and activates the Janus kinase-signal transducer and activator of transcription (JAK/STAT) intracellular…
Hes1. These transcription aspects promote the expression in the bone morphogenic protein 4 (BMP4) and bone morphogenic protein 7 (BMP7), which are both accountable for the activation of Six3 and…
roups: a handle group (phosphate-buffered saline (PBS)) and 4 groups including i.v. administration of a CPT11 remedy, oral administration of CPT11 alone in water by an injection in LBSNENPs (PC90C10P0),…
and improvement has been GlyT2 Accession documented within this program . Olfaction plays an vital function in forming and keeping the hugely specific mutualism involving a fig and its corresponding…
Roplets . Due to the fact sterol esters are typically in low abundance, an increaseRoplets . Due to the fact sterol esters are commonly in low abundance, a rise in…
t for the kind and volume of phosphatidylcholine, the lipid/clotrimazole molar ratio plus the solvent employed in the preparation on the buffers, becoming H2O for DSC and 2H2O for NMR.…
roups: a handle group (phosphate-buffered saline (PBS)) and 4 groups such as i.v. administration of a CPT11 option, oral administration of CPT11 alone in water by an injection in LBSNENPs…
0; Sigma ldrich Inc.). The samples from every single therapy had been eNOS Purity & Documentation cleaned with 0.9 NaCl. The clean samples have been homogenized in trichloroacetic acid (1:four,…
ng by RET-induced ROS. Not too long ago, it has been recognized once again that mild inhibition of And so on is often a target inside the mechanism of action…
s (79), can lower cholesterol and fatty acid biosynthesis and atherogenic hyperlipidemia in animal models, suggesting that azathioprine could possess a equivalent effect (80). SREBP-1 also reduces proinflammatory signaling and…
activate the castor oil, which subsequently triggers the metabolic pathways of ricinoleic acid . Such description of cellular and molecular pathways displays the pharmacological guidelines of castor oil identified so…
In the summer, winter, and spring showed a 25 , 18 , and 7 enhance ofIn the summer time, winter, and spring showed a 25 , 18 , and 7…
Persistent pulmonary condition Mild liver illness Mild to moderate diabetes Renal condition Rheumatologic illness iTTP (n = 805) 95 (11.8) 71 (eight.8) 105 (13.0) 74 (9.2) 101 (twelve.five) 145 (18.0)…
will report further investigations of your detoxification mechanism of fenquinotrione in rice inside a subsequent paper (manuscript in preparation). In conclusion, the results with the present study demonstrate that fenquinotrione…
the cytochrome P450 program, which can result in a rise from the half-life and concentration of several drugs, as a result enhancing their toxicity and unwanted side effects . CYP2…
Spectroscopy (Table to 12.three by elemental analysis andthe initial molar ratio ofSpectroscopy (Table to 12.3 by elemental evaluation andthe initial molar ratio on the stabilizing polymer and Cu(II). The stabilizing…
] showed that rats simultaneously treated with mesenchymal stem cells (MSCs) and pioglitazone right after MI considerably enhanced cardiac functions through stimulation of PPAR--regulated Cx43 expression and inhibition of TGF-1/Smad…
118/106 Number of prior chemotherapies 2/3/4 59/86/31 Prior chemotherapy Fluoropyrimidine 176 Irinotecan 174 Oxaliplatin 175 Bevacizumab 163 Anti-EGFR 79 Regorafenib initial dose (mg) 160/120/80/40 122/43/10/43.2/56.8 53.4/46.6 50.6/41.1/1.7/6.3 59.7 33 five.1…
ance, endocrine, power metabolism, digestive technique, protein production, cytoplasmic translation, and regulation (Supplementary Materials, Excels S3 and S4). The Bcl-B Molecular Weight numbers of MCT1 Compound contracted gene families in…
Rradiated (p = are drastically unique (p = 0.0005 for 56Fe had been O andRradiated (p = are significantly various (p = 0.0005 for 56Fe were O and p 0.0001…
ity is that AhR and its regu within the placenta, which could be activated by exposure to IRAK1 Inhibitor Formulation environmental toxicants for the duration of lated genes, CYP1A1, CYP1A2,…
aTC and NaTGC). In the UV-vis absorption and uorescence emission procedures, it is clear that the studied drug molecule (CV) molecule displayed outstanding enhancement in absorption and uorescence emission spectral…
TC) for ligand binding/protein interactions Functional assays Benefits Disadvantages PropensityTC) for ligand binding/protein interactions Functional assays Benefits Disadvantages Propensity of IMP denaturation Probabilities of non-physiological IMP conformations resulting from mismatched…
regarded to your public for its psychoactive effects such as euphoria, rest, greater awareness of sensation, and alteration of aware perception.twelve Among the 60 various ingredients of marijuana, early investigation…
ating COVID-19, it's inevitably crucial to conscious clinicians with regards to the potential ADRs6 of|BISWAS And ROYassociated with the therapies supplied for the COVID-19 individuals. Since it has been replicated…
ous reports and optimized within this study (Lin et al., 2011, 2013; Chen et al., 2016; Su et al., 2018). In addition, most SMEDDSs, as exemplified as LBSNENA in this…
Of CDS Total hypothetical genes tRNA rRNA tmRNA Variety of FunctionalOf CDS Total hypothetical genes tRNA rRNA tmRNA Number of Functional Subsystems Variety of gene clusters responsible for secondary metabolite…
Er sample irradiation (Figure 4B,F), within the summer sample, theEr sample irradiation (Figure 4B,F), inside the summer season sample, the same spin adduct exhibited monophasic kinetics (Figure 4C,G). The signal…
WQ, Wuqia. Added file four: Figure S3. Cross-validation errors inside the ADMIXTURE evaluation. The amount of ancestry (K) was assumed to range from 1 to 10; K = two was…
the model for estrone sulfate, there was an association from the SLCO1B1 c.521CT allele with 62 greater plasma concentrations (p 0.053) when the model was adjusted for sex and included…
sa by subject groups Non-Asian two (3790, 9170) (178, 431) (7.78, eight.17) (2.55, three.25) Asianb 8 3775 (38) 177.1 (37) eight.42 (0.00024.0) 1.600 (49) Japanese 7 3855 (40) 181.two (40)…
C11R6 assemblies have been measured working with nitrogen bases to estimate aqueous-equivalent pKa values.39 Unfortunately, this protocol impairs the precise determination of water content material by either Karl-Fischer titration or…
as in comparison with therapy with high LPS concentrations (100, 101). Despite the fact that, eutherian mammal placentation varies in their invasive and opposing nature between fetus and maternal tissue…
T-treatment inflammatory modifications not requiring additional treatment. 3.two. Targeting Fungal Molecular StructureT-treatment inflammatory alterations not requiring further therapy. three.2. Targeting Fungal Molecular Structure or Pathway Radionuclide imaging permits the noninvasive…
Ible light irradiation of ambient particles, could be attributed to theirIble light irradiation of ambient particles, might be attributed to their diverse sources responsible for different compositions of air pollution…
. Ethylene is made from methionine by ACC synthase (ACS) and ACC oxidase (ACO) from its precursor 1-aminocyclopropane-1-carboxylic acid (ACC). The outcomes presented herein revealed that S-adenosylmethionine synthase-like genes ACC…
J, et al. Trends inside the Prescription and Long-Term Utilization of Antidementia Drugs Amongst Patients with Alzheimer's Disease in Spain: a Cohort Study Applying the Registry of 15-LOX Inhibitor Purity…
ance, endocrine, energy metabolism, digestive program, protein production, cytoplasmic translation, and regulation (Cathepsin K Biological Activity Supplementary Supplies, Excels S3 and S4). The numbers of contracted gene households in genus…
]. The production of NTR2 Compound 18-hydroxyCLA by SbMAX1a is much more efficient]. The production of 18-hydroxyCLA by SbMAX1a is much far more effective than all the SL synthetic CYPs…
N the two protein systems.Evidence-Based Complementary and Option Medicine three.four. PPIN the two protein systems.Evidence-Based Complementary and Alternative Medicine 3.four. PPI MMP-13 Inhibitor Species Network Building and Core Target Analyses.…
nt response overwhelms the antioxidant response inside the brain. three.2. Pressure Response Through anxiety, the physique produces an adaptive response to reestablish the homeostasis that has been disrupted by the…
patocytes, nevertheless it is competitively oxidized by CYP3A in to the inactive NF-κB medchemexpress metabolites of APC and NPC. However, SN-38 is inactivated in the liver via glucuronidation to SN-38G…
aTC and NaTGC). In the UV-vis absorption and uorescence emission approaches, it really is clear that the studied drug molecule (CV) molecule displayed outstanding enhancement in absorption and uorescence emission…
, enzymes that could activate HGF. To our understanding, ourFigure 11. HGF expression, enzymes which will activate HGF. To our knowledge, ourFigure 11. HGF expression is reduced inside the liver…
e involvement of auxin in numerous cellular events, we anticipated to seek out unigenes belonging towards the SAUR loved ones amongst upregulated and downregulated genesFrontiers in Plant Science | frontiersin.orgAugust…
contracted gene families in internal expanded/contracted gene households ingiven in blue for each and every clade. Myr suggests one particular million years. gene families are shown in red). Taxonomic information…
S in lipid-likeFurthermore, the isolatedconducting extensive studies have to be obtainedS in lipid-likeFurthermore, the isolatedconducting in depth research need to be obtained at concentrations and purity, which are satisfactory for…
Nd genetic complexity among Glyoxalase (GLO) list LHON-Plus sufferers. Additionally, LHON-Plus is just not aNd genetic complexity among LHON-Plus patients. Furthermore, LHON-Plus is not a mitochondrial disease limited to young…
these formulations bypass metabolism by CYP3A4 enzymes in the liver, they may be a greater selection for patients at risk for possible drug-drug interactions (81, 82, 86). Transdermal formulations are…
0; Sigma ldrich Inc.). The samples from each and every treatment have been cleaned with 0.9 NaCl. The clean samples have been homogenized in trichloroacetic acid (1:4, w/v) employing a…
Ential oil and pulsed iron oxide nanoparticles significantly inhibited the fungalEntial oil and pulsed iron oxide nanoparticles significantly inhibited the fungal adherence of C. albicans and C. tropicalis. Additionally, the…
lic pathway (43, 44), which could play a function through VA treatment. For that reason, it was recommended that ornithine may well be a promising biomarker of VA therapy for…
tion with compounds targeting LXR could additional modulate lipid rafts and AIRD drug efficacies remains to become explored. In some situations, the dose of lipid-modifying therapies should be adjusted after…
contracted gene households in internal expanded/contracted gene households ingiven in blue for each and every clade. Myr signifies one particular million years. gene families are shown in red). Taxonomic information…
D, experimental days.Frontiers in Endocrinology | www.frontiersinDecember 2021 | Volume 12 | ArticleYuan etD, experimental days.Frontiers in Endocrinology | www.frontiersinDecember 2021 | Volume 12 | ArticleYuan et al.Identification Functions of…
MP Hepatocytes Melanocytes B.cells Skeletal.muscle Pericytes Macrophages.M1 Plasma.MP Hepatocytes Melanocytes B.cells Skeletal.muscle Pericytes Macrophages.M1 Plasma.cells CD4..T.cells Endothelial.cells Erythrocytes CD4..Tcm CLP Epithelial.cells mv.Endothelial.cells Keratinocytes Osteoblast MSC pro.B.cells Th1.cells -0.25 0.00 0.pvalue0.04…
D to the remission of antidepressant therapy .e final results of GOD for the remission of antidepressant treatment .e results of GO analysis are shown in Figure four. BP analysis…
ovulation inside the mouse ovary. Biol Reprod 2000; 62:Bradykinin B2 Receptor (B2R) Antagonist site 1059066. DeFalco T, Potter SJ, Williams AV, Waller B, Kan MJ, Capel B. Macrophages contribute to…
), lipoxygenase, and cytochrome p450 (CYP) enzymes (20, 22). Downstream eicosanoid ADAM17 Inhibitor MedChemExpress signaling can have a direct metabolic effect on immune cell subsets via the modulation of PPARs,…
activate the castor oil, which subsequently triggers the metabolic pathways of ricinoleic acid . Such description of cellular and molecular pathways displays the pharmacological rules of castor oil identified so…
-, and MRP4-mediated uptake of probe substrates taurocholic acid-, and MRP4-mediated uptake of probe substrates taurocholic acid (1 ), Sodium Channel Inhibitor supplier ethacrynic acid glutathione conjugate (1 ), estradiol…
Stance Linked to Infertility Progesterone is regarded the `pregnancy hormone' for the reason thatStance Linked to Infertility Progesterone is considered the `pregnancy hormone' for the reason that of its function…
gi . Modifications within the activity of transcriptional regulators elicit overproduction modifications in specific transcription variables, and this regulatory program appears to be of MFS transporters . conserved in filamentous…
s (79), can lessen cholesterol and fatty acid biosynthesis and atherogenic hyperlipidemia in animal models, suggesting that azathioprine could have a comparable impact (80). PDE2 Formulation SREBP-1 also reduces proinflammatory…
mechanism of action of antiviral response genes. IFNT binds to variety I IFN receptors (IFNAR) 1 and 2 and activates the Janus kinase-signal transducer and activator of transcription (JAK/STAT) intracellular…
Iform distribution in extra compact or related planes for the projectedIform distribution in extra compact or related planes for the projected PC2 vs PC3 (centered amongst - ten to +…
Ility to maintain PPARβ/δ Activator manufacturer integrity and shape upon dilution. This overcomes theIlity to retain integrity and shape upon dilution. This overcomes the shortcomings of lipid bicelles and supplies…
C response remained non-significant. This outcome highlights the possibility that variants in this gene possess a non-pleiotropic impact on statin ADRs (Donnelly et al., 2011). A post hoc energy analysis…
tion with compounds targeting LXR could additional modulate lipid rafts and AIRD drug efficacies remains to become explored. In some situations, the dose of lipid-modifying therapies should be adjusted once…
in interaction. JEG-3 cells, which express both functional TLR4 and higher E-cadherin levels, showed a mild or an intermediate reaction to bacterial stimulation. Cytokines inside the supernatant of bacteria-treated JEG-3…
Of other plant hormones. Auxin response variables (ARFs) are transcriptionally regulatedOf other plant hormones. Auxin response components (ARFs) are transcriptionally regulated by BRs inside a transcriptional feedback loop . BIN2…
14 16 32 19.48 6.59 20 16 13 18 31 26 9 19 7.53 Ir 11 17 15 14 16 11 ten 7 13 17 11 six 10 10 13…
ating COVID-19, it is actually inevitably crucial to conscious clinicians with regards to the prospective ADRs6 of|BISWAS And ROYassociated using the HD2 drug therapies supplied to the COVID-19 patients. Due…
Se (YNB) (BD Biosciences, San Jose, CA, Usa), 1.25 g ammoniumSe (YNB) (BD Biosciences, San Jose, CA, United states of america), 1.25 g ammonium sulfate dissolved in 200 ml distilled…
caling. Illness activity in each patient was also scored by Physician's Global Assessment scale. The biopsies of pretreatment and posttreatment skin have been compared with wholesome skin. In these biopsies,…
renal impairment or creatinine clearance significantly less than 9 mL/min.138 On the contrary, donepezil disposition will not be affected by renal dysfunction. The renal clearance of donepezil in individuals with…
as given towards the animals on the manage group (I) as autos and loperamide (three mg/kg; b.w., i.p.) to Group II (good handle) as a normal antimotility drug. Mice within…
Nome alignment paradigm (http:// genomewiki.ucsc/index.php/Whole_genome_alignmentNome alignment paradigm (http:// genomewiki.ucsc/index.php/Whole_genome_alignment_howto) as a way to receive a contiguous pairwise alignment plus the `chain' file input for liftOver (kent source version 418). The…
Ccharide production. metabolism", and "propanoate metabolism". The findings also suggested thatCcharide production. metabolism", and "propanoate metabolism". The findings also recommended that N. aurantialba had a higher capacity for polysaccharide production.…
E 3A) was paralleled by a 10-fold greater ALDH1A3 proteinE 3A) was paralleled by a 10-fold larger ALDH1A3 protein abundance in LK7 when compared with LK17 pGSCs (Figure 3B,C). Consistently…
hese two fields, as outlined by McDonald (1997), by walking D1 Receptor Inhibitor web diagonally across the field and collecting a leaf every meter from a corner for the center…
tion with compounds targeting LXR could further modulate lipid rafts and AIRD drug efficacies remains to be explored. In some situations, the dose of lipid-modifying therapies should be adjusted after…
contracted gene households in internal expanded/contracted gene households ingiven in blue for every single clade. Myr means 1 million years. gene households are shown in red). Taxonomic facts can also…
SphK2 medchemexpress AlNBThe table lists the hyperparameters which are accepted by ATP Synthase Storage & Stability diverse NaAlNBThe table lists the hyperparameters that are accepted by distinct Na e Bayes…
Lines sharing precisely the same haplotype using the R ggpubr program53. EthicsLines sharing precisely the same haplotype applying the R ggpubr program53. Ethics declarations. Experiments on wheat were carried out…
pid parameters in oat group (A) and in handle (B) group. Correlation values in bold indicate significance. TC, total cholesterol; TG, total triglyceride; HDL-C, high-density lipoprotein cholesterol; LDL, low-density lipoprotein…
romycin Antifungal drugs Fluconazole Ketoconazole Antiarrhythmic drugs Amiodarone Antipsychotics Haloperidol Antidepressants SertralineOutcomes Increased plasma concentration of donepezil and galantamine Hypercholinergic outcomes Hypersalivation, abdominal pain, diarrhea, nausea, vomitingAbbreviations: PK, pharmacokinetics; CYP,…
as given towards the animals with the manage group (I) as vehicles and loperamide (3 mg/kg; b.w., i.p.) to Group II (positive control) as a DNMT3 supplier standard antimotility drug.…
Table 1 Transition probabilities Transition Remission to SHP2 medchemexpress relapse For all LAIs, CminTable 1 Transition probabilities Transition Remission to relapse For all LAIs, Cmin 95 ng/mL (SD) For all…
Osome. Following the respiratory burst, the pH on the phagosome increasesOsome. Just after the respiratory burst, the pH of your phagosome increases and becomes alkaline having a pH of roughly…
PLT, platelet count; ITP, immune thrombocytopenia; HELLP syndrome, Hemolysis elevated liver enzymes and low platelets count syndrome; PPH, postpartum haemorrhage; P, P-valuePlatelets 100.000/L Blood group O non-O Platelets/L Haemoglobin g/dl…
y level was evaluated. Values are presented because the mean SEM (n = six) Scale bar: 50 . There is certainly no signiffive groups. icant difference amongst five groups.two.5. Protein…
ating COVID-19, it can be inevitably essential to aware clinicians relating to the possible ADRs6 of|BISWAS And ROYassociated with the therapies supplied for the COVID-19 sufferers. Given that it has…
imental animals infected with trailing isolates generally respond effectively to therapy with all the azoles (25, 26), suggesting that this phenotype won't have an impact on clinical outcomes. Nonetheless, two…
r sufferers under the instruction set. (G) Boxplot of your expression worth of each and every gene in the predictive model. AUC, region below the curve; DEGs, differentially expressed genes;…
mechanism of action of antiviral response genes. IFNT binds to form I IFN receptors (IFNAR) 1 and two and activates the Janus kinase-signal transducer and activator of transcription (JAK/STAT) intracellular…
Nd controls in custom microfluidic devices, and sequestered neuronal cell bodiesNd controls in custom microfluidic devices, and sequestered neuronal cell Imidazoline Receptor Agonist Accession bodies within the main compartment that…
Ek fixed dose period. Patients finishing the study have been then eligibleEk fixed dose period. Individuals completing the study have been then eligible to enter an open-label extension study, which…
r atorvaHDAC6 Inhibitor MedChemExpress statin therapy in comparison with these carriers of each the T allele in rs1045642 and these homozygous for the T allele in rs12975366. In major effects…
roups: a manage group (phosphate-buffered saline (PBS)) and 4 groups such as i.v. administration of a CPT11 answer, oral administration of CPT11 alone in water by an injection in LBSNENPs…
ating COVID-19, it is inevitably critical to conscious clinicians with regards to the prospective ADRs6 of|BISWAS And ROYassociated with all the therapies offered to the COVID-19 patients. Considering the fact…
Culture of SK-BR-3 and mesenchymal stem cells The SK-BR-3 HER2 overexpressingCulture of SK-BR-3 and mesenchymal stem cells The SK-BR-3 HER2 overexpressing cancer cell line was obtained from ATCC, and mesenchymal…
Tained toto week 12.Mild and moderate hot flushes and loss ofTained toto week 12.Mild and moderate hot flushes and loss of week four, four, which was maintained week 12. Mild…
ype . Operate to incorporate equivalent proof primarily based clinical guidelines towards the UK National Overall health Service (NHS) is ongoing . Hence far, research around the putative association in…
tion with compounds targeting LXR could additional modulate lipid rafts and AIRD drug efficacies remains to be explored. In some circumstances, the dose of lipid-modifying therapies have to be adjusted…
as offered to the animals in the control group (I) as cars and ACAT1 manufacturer loperamide (3 mg/kg; b.w., i.p.) to Group II (optimistic handle) as a typical antimotility drug.…
just after oral and intravenous administration, respectively. FRB UCA DB 100 UCB DA (two)where AUC for a LBSNENPs formulation A plus the AUC for the exact same drug in answer…
Way have been identified by KEGG enrichment annotation (Fig. 4: five). KEGG analysis showedWay had been identified by KEGG enrichment annotation (Fig. four: five). KEGG evaluation showed that compared with…
Outcomes of our study demonstrated that irradiation in the cells containingResults of our study demonstrated that irradiation on the cells containing PM2.five , with UVA-visible light drastically decreased the cell…
One particular well contained 900 of media with the tested compound (or 0.1 DMSO within the controls) and four females or 86 males. The medium was supplemented with 0.eight glucose,…
activate the castor oil, which subsequently triggers the metabolic pathways of ricinoleic acid . Such description of cellular and molecular pathways displays the pharmacological rules of castor oil known so…
0; Sigma ldrich Inc.). The samples from every remedy were cleaned with 0.9 NaCl. The clean samples have been homogenized in trichloroacetic acid (1:4, w/v) employing a Teflon homogenizer and…
S present with clinical manifestations of cardiac insufficiency and overlapping symptomsS present with clinical manifestations of cardiac insufficiency and overlapping symptoms and indicators, however they lack specific manifestations. DCM is…
Sion of TNF-/TNFR1/NF-B signaling alleviated neuroinflammation and depression . MolecularSion of TNF-/TNFR1/NF-B signaling alleviated neuroinflammation and depression . Molecular docking was employed to validate the interactions amongst the core compounds…
tMales and females may well respond differently to medications, however understanding about sexual dimorphisms inside the effects of polypharmacy remains limited, particularly in aging. This study aimed to assess the…
. In this study, we conducted extensive nontargeted lipidomics and effectively identified Cer-NDS containing extremely lengthy N-acyl chains (C26 to C30) (see Fig. 1C for the structure) as just about…
Dglycogen synthesis, additional confirmed by decreased levels of Gsk3a. HoweverDglycogen synthesis, further confirmed by decreased levels of Gsk3a. However, decreased hexokinase 1 (Hk1) levels, essential to type glucose-6-phosphate from glucose,…
Ative cells. Furthermore, liposomes represent a continuous membrane due to the fact theyAtive cells. Moreover, liposomes represent a continuous membrane because they're not constrained by a solubilizing scaffold structure. This…
ess is made with POC pharmacogenetic testing. This can be a challenging prospect, and a single that eventually might not be feasible. Even so, it deserves further investigation provided the…
14 16 32 19.48 six.59 20 16 13 18 31 26 9 19 7.53 Ir 11 17 15 14 16 11 ten 7 13 17 11 6 ten 10 13…
0127 0.1397 0.033 0.HR, hazard ratio; 95 CI, 95 Self-assurance Interval.infiltrating immune cells, which includes B0127 0.1397 0.033 0.HR, hazard ratio; 95 CI, 95 Self-assurance Interval.infiltrating immune cells, such as…
Sults are listed inside the Tables 1 and two by numerical designation. TheSults are listed in the Tables 1 and 2 by numerical designation. The TrkA Inhibitor Source compounds had…
ation and Lead to Heparin-induced Thrombocytopenia (HIT) B. Singh1; C. Jones2; D.A. Garcia3; N. Leung1; R.S. Go1; R. Leger1; N. Heikal1; R. Pruthi1; D. Chen1; A. Padmanabhandose heparin (Table one).…
0; Sigma ldrich Inc.). The samples from every single treatment had been cleaned with 0.9 NaCl. The clean samples had been homogenized in trichloroacetic acid (1:four, w/v) making use of…
Management goods. 3.three. Lipids Lipids are crucial macromolecules and vital constituents of power reservoirs and signaling, molecules critical for the integrity and functionality of cellular membranes. Algae contain the majority…
En in English as much as September 2020 were deemed. A total of 60 research have been integrated in the systematic evaluation. Based on in vitro findings, 19 out of…
Biological activities. The . . . primary ER isoforms are ERa and ERb (Lee et al., 2012). It can be believed . . . that CBP/p300 Inhibitor drug oestrogen signalling…
Tion, thereby limiting tissue damage . To this end, a promising candidate for enhancing TB immunopathology could be the inducible antioxidant protein, hemePublisher's Note: MDPI stays neutral with regard to…
On levels positively corGlycopeptide Purity & Documentation related tothose of AHNAK and TGFB1. Activated TGFB1 phosphorylates Smad2 and Smad3 proteins. These Smad proteins activated by phosphorylation acts as transcription things…
Ulated across all bmr12 and wild-type plants, regardless of other situations, by Wilcoxon rank-sum tests. They're Fatty Acid Synthase (FASN) medchemexpress presented separated by watering condition and inoculum. Numbers above…
Rous and HCC tissues in the other 3 individuals have been β adrenergic receptor Agonist site utilised for totalCHAI et al.3 ofproteome and acetylome quantification by label-free quantitative proteomics. 3…
Influx and aids enhance Arabidopsis tolerance to salt strain . Inside the existing study, we found that key genes within the ABA signaling pathway of S. alopecuroides roots have been…
Ted accessions is reported in More file 1: Table S11. It is actually worth specifying the mother plants from where the single vines planted in collection have been propagated underwent…
Te, 0.1 Triton X-100, 50 /mL propidium iodide (PI)] for 120 min at 4 C. Just after lysis, the PI fluorescence was measured via flow cytometry. PI binds stoichiometrically to…
1 improved by 1.2- fold along with the conversion of -pregnenolone into -17-hydroxyprogesterone was inhibited by 147 . These data indicated that 3-HSD activity (conversion of -pregnenolone to -progesterone) was…
Pine. two.2.2. Antipsychotic Adverse Effects The genetic data for antipsychotic tolerability isn't as consistent as those for antipsychotic efficacy, except for weight acquire. The margin for controversial outcomes is substantially…
Ted accessions is reported in Additional file 1: Table S11. It really is worth specifying the mother plants from exactly where the single vines planted in collection had been propagated…
He IM gene expression, also as copy quantity variation (CNV), including amplification and deletion (Figure 4A, Table S8). In general, the gene expression differences of IMs across immune subtypes were…
Ons inside the group of individuals with systemic inflammation. Though the sample of individuals within this analysis was small, this observation calls for focus and study inside a bigger quantity…
At space temperature. An typical count and weight have been obtained for every single cluster.Inspection of seeds and traces of reproductive structures at veraisonBunch, berry and seed traits have been…
An epithelial phenotype to a mesenchymalfor metastasis. Utilizing miRNAs and epithelial phenotype to a mesenchymal 1 in preparation 1 in preparation for metastasis. Utilizing miRNAs along with other non-coding RNAs…
D kidney dysfunction when utilized at a high dose and for any long term. Two studies showed that the shortterm perioperative use (much less than two weeks) of parecoxib/valdecoxib by…
Ng dynamic exclusion. The scan variety covered 70,000 m=z. A total of 749 and 744 compounds had been detected in serum (Excel Table S5) and cecum (Excel Table S6), respectively.…
Dren now survive at least 5 years soon after cancer diagnosis.51 Notably, these childhood and adolescent cancer survivors possess a 7-fold increased danger of cardiovasculardeath when compared together with the…
Cancer cell lines (152, 15759).connected with larger mortality in respiratory cancers furthermore to larger all-cancer mortality inside a Chinese study (163). CCB intake has been observed to become related to…
City without the need of additional benefit in Caspase 4 Activator Source sufferers with functional gastrointestinal tracts as discussed previously .Table 7. Nonpharmacologic Interventions for Postoperative Analgesia and Comfort. Category…
Creases in glutamate in the medial preoptic places (Ferraro et al., 1996b), posterior hypothalamus (Ferraro et al., 1996b), thalamus (Ferraro et al., 1997a), hippocampus (Ferraro et al., 1997a), and striatum…
He oligonucleotide probes, the extraction of nuclear protein, and EMSA followed the protocols by Wei et al. and Zhao et al. . two.three.eight. Statistical Analysis Just before statistical analysis, we…
Ametophyte formation and function , in particular in microspore development, e.g. , and in pollen tube growth ( and references herein). Other members of the AHA family have been shown…
H is situated in the motif E in the palm subdomain with its function getting to monitor the right positioning of your finish with the primer (Fig. 2C) . Other…
S156 and, by a slightly distinctive mechanism, sulfamides157 are converted to nitrosamines in high yields through ozonation, but these precursors aren't commonly present in substantial concentrations.13,14 Therefore, in quite a…
Estinal barrierGastroenterology. Author manuscript; offered in PMC 2022 June 01.Mahurkar-Joshi et al.Pagedysfunction, motor abnormalities, and visceral pain in IBS6,7. Even though the etiology of IBS is incompletely understood, there is…
Ng Technology): rabbit anti-Stat3 (#12640), rabbit antiphosphorylated (p)-Stat3 (P-Tyr705) (#9145), rabbit anti-Bad (#9239), rabbit anti-p-Bad (P-Ser122) (#5284), rabbit anti-p53 (#2527), and rabbit anti-p-p53 (P-Ser15) (#9284). Protein expression levels were IL-6…
N O21 and C4 atom increased, the energy from the system went down 1st, then up immediately. This indicates that inside the doublet state, the reaction involving oxygen molecule and…
Amongst microarray and qPCR for all validated transcripts, whereas the impact size (worth of FC) differed to some extent for the validated PRMT1 Inhibitor medchemexpress transcripts among microarray and qPCR.…
Bsequent MR analysis showed strong evidence of an association of BMI with invasive epithelial OC. Additionally, association of BMI with HGSC, endometrioid carcinoma, and low malignant potential tumors but not…
He anti-obesity efficacy of several natural goods. Figure two. two. List of numerous parameters for assessing the anti-obesity efficacy of several natural merchandise.Ghrelin is also referred to as the hunger…
On levels positively correlated tothose of AHNAK and TGFB1. Activated TGFB1 phosphorylates Smad2 and Smad3 proteins. These Smad proteins activated by phosphorylation acts as transcription variables by assembling with Smad4…
The up-regulated genes include the sorghum orthologue of the widely known LysM motif receptor kinase (LYK5) (Sobic.004G076100), leucine wealthy repeat (LRR) receptor-like serine/threonine-protein kinase (Sobic.006G217900) and somatic embryogenesis receptor-like kinase…
Lysine 27 (H3K27), and H3K27 trimethylation (H3K27me3) will be the important mechanism for transcriptional repression (Ferrari et al., 2014). EZH2 is up-regulated in a variety of cancer varieties, for instance…
D at 4 for 16 h with each and every principal antibody and for 30 min at room temperature with the suitable secondary antibody. Principal antibodies had been precise the…
Hes. The reduction of oxidized methionine is catalyzed by methionine sulfoxide reductase , although oxidized cysteine is transformed into cysteine by different proteins which includes glutaredoxins, thioredoxins, and thioredoxins reductase…
Metabolites also as LC/MS signal noise; Mahieu and Patti, 2017), the amount of intact Phe-derived metabolites is TLR2 Antagonist Synonyms likely a lot less than three,000. Here, we show that…
To females. Mean 1 SEM; person data points are shown, pp , 0.05, rection. We utilised RRHO as a threshold-free technique to pppp , 0.001, n = 109. evaluate the…
Re expressed in development method of deutonymph total. The differential CDK8 supplier expression genes (DEGs) (fold modify two.0 and pp 0.01) throughout various The differential expression genes (DEGs) (fold modify…
Eceptor (TFRC), aldo-keto reductase loved ones 11 member C2 (AKR1C2) and, a coding transcript of of Multidrug resistance-associated protein 1 (ABCC2) (Figure 3A,B). non-coding transcript the the Multidrug resistance-associated protein…
Ligand (TRAIL), was shown to raise apoptosis in human HCC cultures . JNK1 correlates directly with poor therapeutic response to sorafenib, a multikinase inhibitor that is the only treatment approved…
Ities of extracellular matrix within the surrounding region . The gene annotation evaluation outcomes help our findings around the enriched cellular elements of extracellular matrix and ECM-receptor interaction pathway. We…
Roles of NO, the direct and indirect effects by which this molecule influences kidney function and its association with cardiometabolic complications. I also highlight novel approaches to restoring NO homeostasis…
Issue receptor (EGFR), and anaplastic α9β1 supplier lymphoma kinase (ALK) genes have already been identified to be prevalent oncogenic drivers (five). These abnormalities of specific molecular and signaling pathways is…
Have been identified in Rt vs. St, including 1594 (66.0 ) up-regulated genes and 820 (34.0 ) down-regulated genes, and the log2 fold-change of most DEGs was about + 1…
This report, the authors also found elevated dangers in oral, breast, and basal cell cancer, although the decreased risk in prostate cancer in t allele carriers of TaqI polymorphism; improved…
The previously talked about genes in multigene phylogenetic analyses incorporate acl1, tub2, CaM, and rpb1. These markers have variable resolution or applicability based around the genus or species complex. For…
Enzymes, NAPE-PLD and FAAH . Whilst 9 -THC exposure did not cause any changesInt. J. Mol. Sci. 2021, 22,8 ofin placental 2-AG levels or the expression of DAGL, 9 -THC…
Diversity and usually do not genuinely reflect person effects.Statistical AnalysesStatistical procedures were performed working with Statgraphics plus 5.1 application (Manugistics, Inc., Rockville, MD, Usa). All information have been subjected to…
O Nero and Moscato Bianco mutant were vital, whereas the majority of these of Chasselas apyr e and Corinthe Noir were not. When potentially viable seeds have been dissected, a…
To differentiate the contribution of actinobacteria and proteobacteria in Progesterone Receptor web environmental oestrogen degradation. As a result, 4-hydroxyestrone 4,5-dioxygenase genes along with the extracellular metabolites PEA and HIP had…
Ich allows the detection and quantification of glucose released in the reaction. We focused our overview on studies that utilized the colorimetric spectrophotometric approach to evaluate the alpha-glucosidase inhibitory activity…
Transformation of microglia to proinflammatory M1 phenotype and may well avoid cognition deficit because there had been synergistic effects in the inhibition of your redox-sensitive NF-B (nuclear factor- light-chain enhancer…
Hambers had been assigned pseudo-randomly if no side preference was discovered. Locomotor sensitization 1 cohort of animals had been utilized to examine locomotor sensitization a minimum of 1 month following…
Dazolam mixture, 35 studies were simulated and in comparison to observations. Though the majority (26 of 35 studies) is usually described extremely effectively, the bring about in the deviation for…
Sity with the protein bands was measured making use of ImageJ 1.51s application (National Institutes of Overall health). Experiments had been repeated in triplicates. Total RNA isolation. Total RNA was…
Challenged this practice, and specialists cite multiple reasons for supporting perioperative continuation more than interruption. Firstly, buprenorphine is now better understood as an efficacious analgesic, and likely 1 with no…
Ere analytical grade chemicals. two.2. Media, Bacterial Strains and Vectors The media, bacterial strains and vectors used in this study are given in Table 1. The P1 and P2 is…
S alleles, form two); five plants (7 ) exhibited loss of Sangiovese/CB2 drug Corinto Nero heterozygosity in 1 or extra microsatellite loci at the same time as extra exogenous alleles…
Type of clusters inside the genome. On chromosome 19 of the human cell, the CYP2B gene resides in one such cluster of six subfamilies,such as the CYP2A, CYP2B, CYP2F, CYP2G,…
Ched. This study also incorporates maximum dose level proposed when the MTD isn't reached. This study also consists of adult adult participants with sophisticated solid tumors and pediatric and young…
Om every of your experimental groups had been defrosted and rinsed with water, and their heads have been removed with a scalpel to reduce the esophagus. The comprehensive alimentary canal…
Ion. Moreover, Cathepsin K MedChemExpress higher ETNK2 mRNA BACE1 supplier expression was also an independent risk aspect for hepatic metastasis and hepatic recurrence, supporting our hypothesis that ETNK2 preferentially promotes…
Omposed a greater degree of activated mast cells. In addition, TIME subtypes exhibited a distinct genetic and transcriptional function: kind III was observed to possess the highest mutation rate (77.92…
Was observed with WES in F2, F5, F7, F10, F12, and F13 (n = 13) showed that this SNP existed in each of the described households and handle samples (n…
Meiosis entry of female and male within a stra8 independent model.Materials AND Strategies AnimalsLaboratory reared medaka (Oryzias latipes, Class Actinopterygii, order Beloniformes, family Adrianichthyidae) had been used. For detailed description…
Om each and every of your experimental groups have been defrosted and β-lactam Compound rinsed with water, and their heads were removed using a scalpel to cut the esophagus. The…
Ting point. In truth, functional studies concerning all-natural RNA-transfer mechanisms, also as their possible for bioactive delivery of exogenous RNA molecules, are required. Noteworthily, it's vital to not merely unravel…
E setting of a randomized, double-blind, activecontrolled clinical trial, the possibility of therapy selection bias and treatment-related management choices are minimized. Other strengths of this analysis will be the inclusion…
Whitefly management and has been extensively studied . C. fumosorosea-based formulations have already been commercially available since the 1990s for the management of whitefly . Encarsia formosa Gahan (Hymenoptera: Aphelinidae)…
He slow conversion of EI to EI, if this is slow (32). Experiments were performed with the inhibitors ketoconazole and clotrimazole, working with a short time scale for the kinetic…
Opens up a new horizon for overcoming this for overcoming this aforementioned wellness challenge. Thesebe encapsulated with biocompatiaforementioned overall health challenge. These biochemicals can biochemicals can be encapsulated with biocompatible…
At the DIC was underlying the improvement of bleeding, or that it may have been a non-symptomatic variety of DIC. It truly is known that tubulointerstitial kidney injury, mediated by…
Immunological ignorance), type III (PD-L1+/TIL-: intrinsic PD-L1 induction), and sort IV (PD-L1-/TIL+: Other suppressors) , which might serve as a more systematic biomarker to stratify sufferers in clinical use of…
Cokinetic properties of losartan can impact its response. 1 study located of losartan. that the CYP2C93 variant reduces losartan metabolism and its hypotensive impact after oral administration of losartan .…
He standard H2 Receptor Agonist site predictions by a population PK model take random inter-individual deviations in CLR into account, they will be directly compared. To acquire the pediatric PBPK…
Parents across the 3 seasons. There was terrific variation in between hybrids in the very same ploidy level as well as between seasons. The flavonoid profiles for each 5-LOX Inhibitor…
O Nero and Moscato Bianco mutant were vital, whereas the majority of these of Chasselas apyr e and Corinthe Noir
Tion for medication selection 3 added visits--Three visits would account for doable involvement of other health care providers (e.g., pharmacists) within the circle of careSCENARIO 5: OHIP+ COVERAGE OF PHARMACOGENOMIC-GUIDED…
Nt E2 production and its connected signaling pathways and by bioactive variables created in preeclampsia. Comprehensive analysis, including clinical and experimental research, has enriched our understanding with the functional modifications…
Ration parameters had been set as in earlier research (Zeng et al., 2020). Metabolite quantification was performed employing multiple-reaction monitoring (MRM) mode (Shi et al., 2020). Partial least squares discriminant…
N avoidance within the presence of 1 DA elicited by ccDA spaced instruction. e Effect of a 2-h recovery period on odor option among 1 BA and DA elicited by…
Actin SNIPERs web represents a necessary element for costamere integrity , re-organization in the subsarcolemmal cytoskeleton might be deemed as putatively accountable for early costamere and integrin-melusin signaling disruption, eventually…
Classification of unfavorable, weak, or sturdy ETNK2 staining intensity. We found that a higher proportion of sufferers with haematogenous recurrence exhibited good ETNK2 expression (weak or powerful staining) in GC…
Miscarriages; on the other hand, in ladies with recurrent miscarriages, both progesterone (PgR) and estradiol (ER) receptors are at their lowest levels within the nNOS Inhibitor Accession cytoplasmic and nuclear…
N concentrations. These results are in agreement with these of other research . On the other hand, Tang et al. identified no statistically significant partnership in between age and plasma…
Hambers were assigned pseudo-randomly if no side preference was located. Locomotor sensitization One cohort of animals had been made use of to examine locomotor sensitization no less than one month…
Tromal cells was noticed, plus the authors hypothesized that the impact of ADT was to arrest tumor growth, in lieu of induction of apoptotic or any other mechanism of cell…
Nce. The terms anabolic and androgenic refer to muscle hypertrophy and enhanced male sex characteristics, respectively. AASs are artificial substances that act on androgen receptors and are frequently used in…
Estinal barrierGastroenterology. Author manuscript; MMP-9 MedChemExpress offered in PMC 2022 June 01.Mahurkar-Joshi et al.Pagedysfunction, motor abnormalities, and visceral pain in IBS6,7. Although the etiology of IBS is incompletely understood, there's…
And all replicative intermediates is usually detected amongst the merchandise. The presence of cccDNA indicates that intracellular hepadnavirus replication takes location within the native transcriptional template outside the chromosome; thus,…
Oginseng. 1) Transposable elements, two) gene density, 3) depth distribution of Illumina reads, red line indicate the anticipated depth, 4) GC content and 5) synteny relations. (e) Insertion occasions of…
Irwise comparisons have been tested by Tukey's postfeeds hoc test. Various letters indicate significant0.01 p worth 0.05; 0.001 p a sampling time point. Study was per- 0.001; are indicated by…
Ich types a 15-C phenylpropanoid core. Flavonoids are grouped into six categories around the basis of the double bond present Mite medchemexpress within the heterocyclic ring and its oxidation status.…
Are well-known to affect cell behavior . There is a long history of bioreactor use in cartilage and bone engineering, but robust methods to create and use bioreactors for liver…
Roteins to kind heterodimer. For instance, PNY interacts using the SHOOTMERISTEMLESS (STM) and BREVIPEDICELLUS (BP). The double mutant bp/pny exhibits synergistic phenotype of your short internodes interspersed together with the…
Hri, 2006a,b). In spite of their FCs, grapefruit fruits and juice include other phytochemicals that have been confirmed to exhibit valuable properties for human health (Hung et al., 2017). Having…
Had been collected at stage E-L 23 (50 caps off) with the modified Eichhorn-Lorenz scheme . No choice was carried out for the inflorescence and shoot position, as pollen viability…
Effects of two black teas, two oolong teas, and two dark teas on liver coefficient, sumption are displayed in Figure 1. Mounting evidence demonstrated that PPARα Inhibitor Compound chronic alcohepatic…
S substantially decreased within the ECH group compared using the alcohol group. e blood-alcohol concentration was 135.40 0.87, 181.00 six.06, 89.48 4.96, and 87.71 4.36 mg/dL in the EtOH, ECL,…
E et al., 2019). Many studies have also demonstrated the validity from the Eplee bag technique as a fantastic screening technique (Ahonsi et al., 2002; Yonli et al., 2006). Previously,…
N and nitrogen atoms inside the 2D material lattice. Accordingly, BN has kindled interest for thermal management, use of its dielectric properties as a support material for bone engineering and…
Has been found related with alterations in early ovule development (defective integument growth and irregular meiosis lowering the production of viable female gametes). A connection involving parthenocarpy and ovule defects…
L models through activation of your oestrogen receptor (ER) . In sufferers with HCC, ERs are present and functional in around 50 of cases, but their function in advertising carcinogenesis…
G, production, and/or manufacturing practices (van Breemen et al., 2008). Induction or BRD4 Modulator Storage & Stability inhibition of cytochrome P450 (CYP) 3A by St. John's wort or grapefruit juice,…
Cted GPX activities in the liver and plasma of yellow catfish. Nonetheless, within the AI and MI of yellow catfish, compared together with the A-Se diet plan, the M-Se diet…
S alleles, type 2); 5 plants (7 ) exhibited loss of Sangiovese/IL-23 Source Corinto Nero heterozygosity in one or much more microsatellite loci as well as more exogenous alleles in…
Have already been demonstrated in kid ney illness models38,118. Additional studies are necessary to investigate the possible clinical added TrkC Inhibitor site benefits of attenuating Nav1.1 Inhibitor drug arginase function…
E maintained per cage in an animal area maintained at a continual temperature of 22 1 C, using a relative humidity involving 50 and 60 , and light/dark cycle of…
And cloned into pEASY-Blunt Zero Cloning Vector (TranGen Biotech, China) for sequencing. Sequence alignments were performed working with DNAMAN six.0 application. 4.five. Subcellular Localization of BcHTT4-GFP Fusions To construct the…
In the ET could be actively involved in the defense response to the infection of V. mali. Furthermore, the expression pattern of ET-related LTC4 Gene ID crucial genes could represent…
T from the original supply. These permissions are granted free of charge by Elsevier for so long as the COVID-19 resource centre remains active.European Journal of Medicinal Chemistry 225 (2021)Contents…
Ed from the three RCTs gave in depth evidence in favor of the security, tolerability, and efficacy of brexanolone. Consequently, it prompted the FDA to giveDiseases 2021, 9,ten ofbrexanolone a…
N a four-way ANOVA, Npas2 mutation differentially affected males and females (sex geno(trending session genotype OVX interaction: F(13,429) = 1.62, p = 0.077). Even though sham mutant females showed moderately…
Ion in the hemoco dsRNA binds to lipophorins in the hemolymph . (F) A. mellifera--Major Royal Jelly Prote dsRNA binds to lipophorins inside the hemolymph . (F) A. mellifera--Major Royal…
D/or substance administration. Because memory encoding and reactivation was performed prior to any pharmacological manipulation (i.e., comparable for each experimental situations) inside the present study, we presumed the differences in…
Etration in to the brain and antiseizure impact can occur earlier than the time required to attain maximum serum concentration . This can be supported by the fact that nasally…
Egatively regulating female sex hormone release . For instance, CART was expressed each in granulosa cells and theca cells . CART signaling has been reported to inhibit the capacity of…
N a four-way ANOVA, Npas2 mutation differentially impacted males and females (sex geno(trending MT2 Purity & Documentation session genotype OVX interaction: F(13,429) = 1.62, p = 0.077). When sham mutant…
Le diplogametes we focused on the genetic make-up of triploid seedlings at microsatellite loci which might be heterozygous in Corinto Nero, as suggested by . Segregation of Corinto Nero alleles…
D gene (PRX and CYP) indicated that the standard cell wall metabolism may be disturbed and that the hypersensitive response may be inhibited by R. Mcl-1 Inhibitor drug solanacearum infection…
On and promoted apoptosis of uterine fibroid cells. MiR-129 expression was repressed by SphK2 Formulation estrogen and progesterone, and its downregulation was effective towards the development of uterine fibroids. TET1…
Lized metabolites. The identification of seven BGCs connected together with the production of PKS and NRPS products inside the blue-ringed octopus isolate, HM-SA03, renders it a a part of a…
D at 4 for 16 h with every single main antibody and for 30 min at area temperature using the acceptable secondary antibody. Main antibodies have been precise the following…
Ng Technologies): rabbit anti-Stat3 (#12640), rabbit antiphosphorylated (p)-Stat3 (P-Tyr705) (#9145), rabbit anti-Bad (#9239), rabbit anti-p-Bad (P-Ser122) (#5284), rabbit anti-p53 (#2527), and rabbit anti-p-p53 (P-Ser15) (#9284). Protein expression levels have been…
Information recommend BCRP (encoded by ABCG2) and MRP2 may possibly mediate TAK-243 efflux, and modifications in BCRP and/or MRP2 expression might explain the resistance to TAK-243 just after BEND3 knockout.…
Nded to KEGG pathways had been enriched in 129 metabolic pathways, and most of these genes were involved in metabolic pathways (ko01100) (four,306 genes), biosynthesis of secondary metabolites (ko01110) (1,677…
Mption is that: IV. The associations are linear and not impacted by statistical interactions (6). In MR studies, researchers initially recognize and extract information for SNPs related with exposure at…
Have been collected at stage E-L 23 (50 caps off) in the modified Eichhorn-Lorenz scheme . No choice was carried out for the inflorescence and shoot position, as pollen viability…
Concentrations (i.e. totally free plus bound types) through unassisted pregnancies (Evans et al., 1998). The main supply of this substance duringCorpus luteum and preeclampsiapregnancy is thought to become decidualized endometrial…
Nephelus coioides) brain cells; on the other hand, the detailed mechanisms of this action remain unknown. In this study, we discovered that the host translation element, polyadenylate P2Y14 Receptor list…
SER membrane to preserve its enzymatic activity. Moreover, currently, it really is recognized that at least the Trp-270 residue in the alfa-helix TMS is highly relevant to suitable HO-1 oligomerization,…
Ce traveled by (red) precisely the same larva depicted inside a. c PMP in (a) and its specific stages. Shown are mhc CaMP (blue) and aspect ratio (AR-GCaMP, green) fluctuations.…
Tic lipid cores and thin fibrous caps have been observed in the water-2-week and water-5-week groups, whereas MMI administration for two and five weeks certainly enhanced the thickness from the…
Ded and seedless accessions. Possible polymorphisms in between somatic variants had been validated via PCR amplification and Sanger sequencing. Within a handful of situations, a subset of putative SNPs was…
Ased IL-6 and hyperstimulation with the mammalian target of rapamycin (i.e., mTOR). The mTOR can also be activated by glucose and insulin, and insulin resistance can also be intrinsically linked…
Exilate is definitely an oral prodrug that is definitely hydrolysed towards the direct thrombin inhibitor dabigatran. The concentration of dabigatran was assessed in mouse plasma samples using a UPLC-MS/MS approach.…
Piprazole (Meulendijks et al. 2010). Probably the most current study assessing the threat of HN below treatment with APDs examined the partnership among receptor occupancy of APDs and HN. Whilst…
C intake than WT littermate mice and we restricted the total caloric intake of Fut2-/- mice to produce it equal towards the caloric intake of WT mice in the course…
Ing region or epigenetic mechanisms exist that may have altered Mdr1 gene expression within the impacted goat. Within this case, however, besides pharmacogenetic and epigenetic causes, other motives responsible for…
This report, the authors also identified increased risks in oral, breast, and basal cell cancer, though the decreased threat in prostate cancer in t allele carriers of TaqI polymorphism; improved…
He oligonucleotide probes, the extraction of nuclear protein, and EMSA followed the protocols by Wei et al. and Zhao et al. . 2.three.8. Statistical Evaluation Just before statistical analysis, we…
Le). Statistical analysis The nature on the data collected was mostly counted data and is presented in the form of cross-tabulations. For continuously scaled measures (e.g. 25-OH vitamin D level),…
N that the majority of cohort research start information collection in the initially prenatal check out, or normally sometime soon after. Earlier recruitment tactics about the practical experience of a…
Rols. g RC32 did not inhibit Calcineurin. Jurkat cells were pretreated with RC32 or FK506 for 4 h and then stimulated with ionomycin (1 g/mL) and PMA (20 ng/mL) for…
Sis (Figure 4B and S4A, B). ASH1L knockdown substantially compromised the in vitro PARP1 Inhibitor medchemexpress development and clonogenic activity of HSPCs transformed by MLL oncogenes, but did not influence…
Lammation, eosinophilia and mucus productionConsidering that na e DO11.10+ CD4+ T cells were proliferating more in a lymphopenic atmosphere and considering that we wanted to focus on the effector functions…
Triggered by polysorbate 80, serum protein competition and rapid nanoparticle degradation in the blood . The brain entry mechanism of PBCA nanoparticles soon after their i.v. administration continues to be…
Ncubation with cell lysates, a mixture of phospho-site-specific biotinylated antibodies was used to detect phosphorylated MAPKs. The phospho-MAPK array displays that ERK1 (MAPK3) phosphorylation was notably increased while in the…
Happen to be linked for the improvement of diseases for example obesity and diabetes including SPARC and LGALS3BP. Summary/conclusion: Exosomes contain novel and cell-type-specific proteins that could possibly be involved…
Antification for the phosphorylation of NF-B (p NF-B), normalized to total NF-B (tNF-B) and -actin (reduce). Inside the I/R brain, phosphorylation of NF-B was significantly elevated. ## P 0.01 vs.…
D altered ECM synthesis, further highlighting the possible value of cell mechanics inside the wound repair approach.20,28 We've recently established 3-D culture models which assistance keratocyte differentiation in serum-free media,…
Apeutic doses of antioxidant and omega-3 supplements, or anti-inflammatory medication a single month prior to the study; or (f) were pregnant or lactating girls. We statistically accounted for the possible…
Afficking or biogenesis components provide a further intriguing avenue to handle EBV connected cancer progression and metastasis. A single current study investigated the protein content of exosomes developed by human…
Re the illness. There are quite a few new treatment options for OA like cell therapy and gene therapy. This articles outlines the notion behind TissueGene-C, a brand new biological…
Nding protein- (C/EBP), which results in reducing the mass of brown adipose IP Antagonist Storage & Stability tissue . Furthermore, milk-derived miRNA-29a is in a position to inhibit the INSIG-1…
Introduced into IR injured mice. Surprisingly, pretreated cells failed to confer the vasculoprotective α9β1 Storage & Stability effects previously observed by naive MSCs within the jejunum. Nevertheless, in contrast, previously…
Sustained pharmacodynamics response. Right here we investigate the pharmacological properties of NKTR-255 on NK cells and the VDAC Purity & Documentation effect of NKTR-255 in NK cell-dependent tumor models. Approaches…
O opted for any genetic criterion and discussed presymptomatic diagnosis and variable expression, respectively . We took a various tactic. The aim of our study was to evaluate sufferers having…
Ntain a DNA-binding domain, i.e., the MH1 (Mad homology 1) domain, which is connected via a linker to a transactivation domain, i.e., the MH2 domain. SMAD1, 2, 3, five, and…
Triggered by polysorbate 80, serum protein competition and speedy nanoparticle degradation in the blood . The brain entry mechanism of PBCA ROCK2 custom synthesis nanoparticles right after their i.v. administration…
S accumulate all over the bud and form the dental papilla. Following the bud stage, the epithelial compartment undergoes particular folding through the cap (E14.five) and bell stage (E15.5) .…
St activation . If MSC-derived NO is mediating improvements in vascular tone following IR injury, this effect would likely be observed at later time points, as seen in the ileum…
N of Sost transcription is independent of your ECR5 osteocyte enhancer.Author Manuscript Author Manuscript Author Manuscript Author ManuscriptDISCUSSIONThe skeleton adapts for the demands of its mechanical atmosphere. Despite the fact…
Erena Ibl (University of Natural Sources and Life Sciences, Vienna, Int. J. Mol. Sci. 2017, 18, 703 9 of 22 Austria) that the Hordeum vulgare Vacuolar Protein Sorting 24 (HvVPS24)…
F cleaved proteins in to the conditioned medium. Without MMP-14 (left panels, MMPI vector), no MMP-14-mediated COX-2 Modulator Molecular Weight processing happens. With MMP-14 but in the absence of your…
Or intracellular signaling activities within the liver that happen to be involved in insulin-mediated regulation of glucose homeostasis. In addition, treatment with δ Opioid Receptor/DOR Modulator drug adropin34 six alleviated…
Dothelial cell-non-autonomous pathway To delineate the part of endogenous Del-1 on endothelial cells throughout angiogenesis and particularly on angiogenic sprouting, we employed a three-dimensional angiogenic sprouting assay working with endothelial…
G part on the Wnt -catenin within the formation with the Spemann organizer, it would not be surprising that Otx2 intervenes in this signaling cascade for anterior patterning. Most intriguing…
Ed skin and is induced throughout the proliferation of keratinocytes . Alternatively, WFDC12 is usually a member on the whey acidic protein (WAP) household and WFDC12 ranges in bronchoalveolar lavage…
G neurotoxicity, endothelial cell apoptosis and inflammation , which decreased likelihood of their translation to clinic use. A further obstacle to future solution development is actually a non-specific penetration of…
Omotion of tumor growth and angiogenesis, via EMT and upregulation of stem-cell markers in the tumor cells.Int. J. Mol. Sci. 2020, 21,5 ofTME and this resulted within the promotion of…
Microglial EVs carrying anandamide on their surface market a substantial lower in inhibitory postsynaptic currents of neurons . Consequently, the use of healthier derived microglial EVs could potentially be a…
Ria S. Hansen; Kristine I. M. Blans; Jan T. Rasmussen Molecular Biology and Genetics, Aarhus University, Aarhus, DenmarkPS03.New role of alpha-2-macroglobulin into the shedding of microvesicles Alexandra Laberge1; Akram Ayoub1;…
Have offered an insightful understanding of this situation . They confirmed by microautoradiography and confocal microscopy that the majority of i.v. Ab-TfR was certainly entrapped inside the brain endothelium because…
SR cells. However, we didn't detect improved phosphorylation of AKT2 (Ser-474) and AKT3 (Ser-472) in cisplatin-resistant cells. We conclude that selective phosphorylation of AKT1 is a feature of cisplatin-resistant MCF-7…
Uce experimental findings. Based on the use of needles as molds published by Chrobak et al.19, we as a result developed microfluidic chips with evenly circular microchannels. We inserted the…
Ids, like linoleic acid, which can be naturally transferred to the brain by transporters . Other elements including plasma protein binding, intracellular sequestration, non-target organ uptake can contribute to plasma…
Ore Wnt4 and Tnfs11 mRNA expression. Evaluation of progesterone receptor (PR) expression showed that DIO increases the amount of PR positive cells. Conclusions: Our information indicate that the expression of…
B)(a)Figure 2: IL-6, intracellular calcium chelation, and P2X inhibition protect against the induction of gap junctional communication promoted by TNF- plus ATP or TNF-/IFN-. (a) Graph showing the effect of…
D also in addittional independent groups of control and DLB folks by qPCR. Summary/Conclusion: Even though preliminary, these benefits represent an integrated miRNA profile in plasma-EVs which is probably to…
Specially within the targeted brain regions exactly where ALDH2 Inhibitor manufacturer protein therapeutics needs to become delivered. It has been gradually accepted that significant biological barriers are linked with every…
Frequently unsatisfactory, specifically in elderly populations. As a result, various alternative tactics are becoming explored. The notion of biological therapy isAdv Drug Deliv Rev. Author manuscript; out there in PMC…
Nally, our effects also implicated that phosphorylation was essential for Axl-dependent immune restoration, which was in accordance with thegeneration of soluble Axl. Some oncological scientific studies suggested soluble Axl as…
C DCsFrontiers in Immunology www.frontiersin.orgMarch 2021 Volume 12 ArticleMartin et al.IL-1 Family members Antagonists in SkinFIGURE 5 Role and therapeutic use of anti-inflammatory IL-1 family cytokines in human inflammatory skin…
Us solid tumours and tumour-associated angiogenic blood vessels . A large variety of molecules have already been coupled to the NGR motif (which might be flanked by two cysteine moieties…
Rties in the human and mouse atypical chemerin receptor GPR1 and showed that they behave differently with regards to their interaction with -arrestins. Human hGPR1 interacts with -arrestins as a…
Ids, like linoleic acid, that is naturally transferred towards the brain by transporters . Other factors such as plasma protein binding, intracellular sequestration, non-target organ uptake can contribute to plasma…
Vivo and in vitro (Yu et al., 2020). It has been found that pretreated BMSCs with ATV secrete exosomes that activate the AKT/eNOS signaling mechanism that additional initiates the angiogenesis…
Sticity and quiescent intestinal stem cells7. Earlier operate showed that, with constitutive absence of parietal cells all through development, mature chief cells never ever emerge, and SIRT1 Activator custom synthesis…
Hese downstream modulations can regulate the cell cycle and proliferation of mesodermal cells . The increased expression during the thigh ADSCs could indicate a larger turnover and migratory pattern of…
Nsgenic designs, it's been MT1 medchemexpress observed that mouse embryos expressing HSP60 had been born with congenital atrial septal defects, serious hemorrhage and evidence of increased myocyte apoptosis, which may…
Lysis buffer was added at density of 1 107 cells/ml. Cell lysates have been gently rocked for thirty min at 4 and then centrifuged at 14,000 g for 5 min…
E price and long-term survival have been observed in BA mammary tumor-bearing mice treated with PDT combined with 17-AAG . HSP70 inhibition together with the bacterial cytotoxin SubA fused to…
Ment modalities, cell sorts along with the use of classical senescence markers like SA--gal, p16, ApoJ vs laminin. In this context, it can be also worth mentioning the disparities of…
Benefit in vivo as aconsequence of increased Del-1 secretion by a higher quantity of surviving cells. Indeed, within a follow-up article, we describe the substantive vascularization benefit of making use…
Actors that modulate these processes throughout wound healing in vivo usually are not clear, but are most likely cell type-specific and could consist of effects of wound healing-related cytokines, development…
Unrecognized counter-regulatory mechanism of Tyro3. On top of that, we offered proof that this impact happens independently on the right here described compensatory Mite site regulation from the TAM technique…
L sample. We applied the template in conjunction with the compensation matrix towards the rest with the experimental samples utilizing the numerous file batch tool in Concepts. Focused cells: Unstimulated…
Formed cells . This atmosphere composed of tumor cells, endothelial cells, immune cells, fibroblasts, macrophages, plus the extracellular matrix surrounding or infiltrating tumor tissues, as well as soluble CCR5 Antagonist…
Ding EGF-like ligand, NRG1, NRG2, NRG3, NRG4, and transforming development factor- gene expression. We detected a transient induction of amphiregulin gene expression in response to cisplatin exposure within the 1and…
Ll as suitability for style of sustainedrelease protein formulations. The release rates of encapsulated proteins is often tuned by varying the lactic acid to glycolic acid molar ratio along with…
R cells. Hypoxic CAFs modulate several mechanisms that induce cancer malignancy, which include extracellular matrix (ECM) remodeling, immune evasion, metabolic reprogramming, angiogenesis, metastasis, and drug resistance. Important signaling molecules regulating…
Lization of these peptides. A peptide with low aggregation propensity and adverse charge, known as PepS (for modest amino acid sequence DMISYAGMDPPDMISYAGMD; Tango score, ten.44; pI three.three) (Table 1), was…
Cysteine-rich 9 (MDC9, or ADAM 9) continues to be CXCR Antagonist Accession reported to shed the heparinbinding EGF-like receptor . The two the membraneanchored and soluble (shed) type of this…
Ugated with 3 distinct fluorescent dyes: Alexa Fluor405 (AF405), Alexa Fluor488 (AF488) and Alexa Fluor647 (AF647). Stained EVs have been acquired with both imaging flow cytometry and spectral flow cytometry.…
Erythrinconjugated anti-CD34 (Clone 8G12; BD Biosciences, San Diego, CA) and analysed with FACSARIA.RNA extraction and quantitative reverse transcriptionpolymerase chain reactionRNA was extracted with all the Tri-reagent (MRC Inc., Cincinnati, OH)…
Wound healing (Figure two). 5.1.1. Impaired Early Leukocyte Infiltration and Function Bigger adipocytes are less responsive to external stimuli . Consequently, diabetes is related with impaired stimulated lipolysis as a…
Wkoop recombinants cer-S inhibited not merely the induction from the organizer markers goosecoid and chd, but in addition the ventral marker Xwnt8 and also the panmesodermal marker Xbra (Fig. 3C,…
Ributes for the circadian expression of genes in the intestine and intestinal corticosterone production . Thus, PPAR forwards details in the gastrointestinal flora, which affects host physiology. Furthermore, PPAR has…
Portant throughout the establishment of the tumor microenvironment and the development of tumor immunity. Recently, the role of gd T cells in tumor immunity has received considerable focus and investigation.…
Ins. Lep(ss)-P85(L) crosses the BBB using the leptin transporter, and exhibits improved peripheral PK along with increased accumulation in the brain when compared with unmodified leptin. Lep(ss)-P85(H) also has enhanced…
Amounts of OVA peptide or 10 M HA peptide (50 l/well) at 37 , 7 CO2. After 24 hr, the plates were washed and one hundred l of 1 g/ml…
Lls and fragments. Digest sample for 250 min on a rotating shaker in incubator (37) or in horizontal-shaking water bath preheated to 37 . Add 50 mM EDTA-PBS to a…
Ry cells (Figure 4a), whereas LV_eGFP manage cells supported HIV replication to the identical extent as WT. Conversely, HIV replication was potently HIV-1 Inhibitor manufacturer inhibited inside the LEDGF32530 expressing…
D description from the CPP internalization mechanisms, along with other properties such as stability, toxicity and immunogenicity had been reviewed elsewhere . Here we focus on use of CPPs for…
Ston, Texas, USA. i ORCID ID (https://orcid.org/0000-0002-8172-0784). ii ORCID ID (https://orcid.org/0000-0003-1780-7719).Significance: Cutaneous scarring has an effect on millions of sufferers globally and leads to sizeable fiscal and psychosocial burdens. Offered…
Ures five).0.80 0.70 0.60 0.50 0.40 0.30 0.20 0.10 0.00 Control CeO2 1.0 mg/kg CeO2 three.five mg/kg CeO2 7.0 mg/kgDiscussionInvestigation in the effects that nanomaterials may well have on cellular…
Hat mediates chromatin αvβ3 Antagonist Species association of MLL is consistent with earlier research showing that its contribution in MLL leukemia demands its conserved PWWP domain (14, 17). The latter…
T of intracellular delivery technique determined by EVs. Methods: Secreted EVs were isolated via ultracentrifugation of HeLa cells stably expressing GFP-fused CD63 (an EV (exosome) membrane marker protein) BRD2 Inhibitor…
Gical roles in impacting cell death, plasticity and survival. Thus S1PR4 Purity & Documentation there's a possibility for PRMT1 Storage & Stability off-target effects unless neurotrophins are delivered precisely to…
Remaining evaluated to the remedy of several types of cancer, exhibiting great possible in preclinical scientific studies.120,121 Lately, antibody-based dual imaging (single-photon emission computed tomography/magnetic resonance imaging ) has efficiently…
Arious T cell subsets to this procedure. As the immune system's involvement in wound healing has come towards the forefront of primary wound healing investigate, this assessment serves to summarize…
Focal segmental glomerulosclerosis.75 In addition, it has been proposed that exosome analysis of urine may give better methods to monitor responses towards the treatment of prostatic cancer.76 The above list…
Transmembrane area are double underlined. Prospective N-glycosylation web pages plus the sequence distinctive towards the secretory C-truncated RAGE are boxed. Peptide sequences employed for the preparation of anti-RAGE peptide antibodies…
F 25 mL. After conditioning for 48 hrs, CM2D was harvested underneath sterile conditions. The H2 Receptor Modulator Formulation handle sample consisted of UCXmedium which was hardly ever in make…
Terials 1) can still exploit the extracellular pathways, and two) stay active inside the CNS (or within the case of your nanocarriers are released in to the brain). The essential…
Erythrinconjugated anti-CD34 (Clone 8G12; BD Biosciences, San Diego, CA) and analysed with FACSARIA.RNA extraction and quantitative reverse transcriptionpolymerase chain reactionRNA was extracted with the Tri-reagent (MRC Inc., Cincinnati, OH) and…
Y (Bio-Plex Human Cytokine 27-Plex Panel, Bio-Rad Laboratories, Hercules, CA) containing the following analytes: Interleukin (IL) 1 beta (IL-1), IL-1 receptor antagonist (IL-1Ra), IL-2, IL-4, IL-5, IL-6, IL-7, IL-8 (CXCL8),…
Epends on marpopulation of immunocompetent cells for example row neutrophils and platelet activating factor. Eur J resident macrophages and dendritic cells was Pharmacol 1993;270: 143-9. RB, HO, also observed inside…
To cell surface MULT1 on these MULT1-Ba/F3 target cells. Interestingly, sMULT1 had no impact on killing of BaF/3 cells transduced with MCMV m157, the ligand for the activating Ly49H receptor…
S in ESCs, is downregulated throughout ESC differentiation, and has been implicated inside the regulation of ESC pluripotency. Knockdown of FOXO1 does not alter the self-renewal of ESCs but is…
Ston, Texas, USA. i ORCID ID (https://orcid.org/0000-0002-8172-0784). ii ORCID ID (https://orcid.org/0000-0003-1780-7719).Significance: Cutaneous CDK12 supplier scarring affects countless sufferers globally and leads to important monetary and psychosocial burdens. Provided the immune…
Pare the suggests, a paired t-test or the Student's t-test was used. The information are shown as mean SD. Variations had been regarded as to be important at p 0.05.Supplementary…
Soforms have different functions (32). One example is, only AKT1 is required for proliferation, whereas AKT2 promotes cell cycle exit as a result of p21 binding (32). Likewise, knock-out mice…
Are symptomatic . These signs may perhaps involve weakness, anorexia, right upper quadrant stomach discomfort, dark-colored urine, spider angioma, edema of lower extremities, and jaundice with serum levels of alanine…
O chains, IL-28R and IL-10R, the latter of which can be shared with receptors for the IL-10 family. The structure of IFN bound to its receptor is reminiscent in the…
Tudy, offloading was in spot. Three studies did not prescribe antibiotics during the therapy period. The HbA1c was fairly under manage for many studies. The efficacy of PDGF was mainly…
D EMBL single-cell trainings courses on single cell omics technologies . Testing no matter whether the sort-TLR2 Antagonist manufacturer stream hits the center of test tubes and microtiter plates is…
Formation of T cell rosettes in HL relied to the IS, and activation of rosetting T lymphocytes is dependent around the CD2CD58 interaction (201). Even though CD58 mutations in key…
T; having said that, when overexpressed as recombinant proteins, most BMPs are active. Although noncovalently linked with their GF soon after secretion, the prodomains of most BMPs usually do not…
Ston, Texas, USA. i ORCID ID (https://orcid.org/0000-0002-8172-0784). ii ORCID ID (https://orcid.org/0000-0003-1780-7719).Significance: Cutaneous scarring impacts millions of individuals worldwide and leads to major monetary and psychosocial burdens. Provided the immune system's…
Ected human FM tissues. At 24 hours post infection, the FM viral load was 7.76 105/500ng DNA as measured by qPCR for the MHV-68 early-late lytic gene, ORF-53 (36, 41)…
Mean sem; two-way ANOVA with Sidak multicomparison test; P0.05 and P0.01 in comparison with UI Retnla+/+ mice; #P0.05 in comparison with Retnla +/+ infected mice; information are representative from two…
Ion, triggers MAP kinase cascades, and recruits -arrestins, which market receptor D1 Receptor Antagonist MedChemExpress internalization . In contrast, chemerin binding to CCRL2 will not promote G protein or -arrestin…
Capability of delivered molecules. Below we look at many such Trojan horse approaches employing a variety of targeting ligands for instance antibodies against transferrin receptor (Ab-TfR), antibodies against insulin receptor…
Nally, our final results also implicated that phosphorylation was demanded for Axl-dependent IL-3 Storage & Stability immune restoration, which was in accordance with thegeneration of soluble Axl. Some oncological research…
On the list of major initiators of chondrogenesis of mesenchymal precursor cells, and the differentiation of mesenchymal stem cells (MSC) into chondrocytes also calls for its stimulation. The expression of…
In Physiology www.frontiersin.orgApril 2018 Volume 9 ArticleSegers et al.Endothelial Communication within the Heartangiocrine proteins may very well be part of these pleiotropic effects of statins. Fibroblasts are typically viewed as…
F the channel, which makes up above half the complete dimension in the TRPA1 monomeric protein (466, 1090). The TRPA1 channel is nonselective for monovalent or divalent cations (PCa/PNa =…
Tomic and Molecular Sciences, Academia Sinica, Taipei, Taiwan (Republic of China); dInstitute of Biomedical Informatics, National Yang-Ming University, Taipei, Taiwan (Republic of China); eNational Taiwan University, Taipei, Taiwan (Republic of…
Proach has been utilised in clinical trials for treatment of congenital blindness,160 ischemic conditions,161 and certain varieties of cancer162 and might be used for treatment of chronic wounds. Cutaneous illnesses,…
Otoxic drug gentamicin and hypoxia, induce inflammatory response in SL pericytes. We then investigated the difference in exosome proteomics in normoxia and hypoxia. Strategies: SL pericytes have been obtained from…
D applying NCI CTCAE. Response will utilize Simon's two-stage design. In the 1st stage, 12 subjects might be accrued. If two or fewer responses take place inside 12 m of…
Osomes in inflammatory ailments from the central nervous program (CNS). While in the complex intercellular communication process, exosomes are the smallest membranous nanovesicles originating from endosomes. Exosomes are secreted by…
D description with the CPP PI3KC2β drug internalization mechanisms, and other properties like stability, toxicity and immunogenicity had been reviewed elsewhere . Here we focus on use of CPPs for…
N of protein therapeutics for CNS associated disorders entails ERT for lysosome storage diseases . For instance, -L-iduronidase (rhIDU), an enzyme deficient in mucopolysaccharidosis I (MPS I) was i.t. administered…
Roups. Box plot is for median with 5th and 95th percentiles. P 0.05; P 0.01.tumor gene expression profile, we determined the gene expression profile plus the density of CD68- and…
Y supports these observations, as the direct addition of tumour cells to a vasculogenesis model SSTR4 Activator custom synthesis described by Bishop et al decreased capillary formation (data not shown).…
Ent (Perkin Elmer, FP1012) diluted at 0.5 in TN wash D3 Receptor Antagonist site buffer (TNB) was added for no less than 30 min to sections at room temperature. After…
Introduced into IR δ Opioid Receptor/DOR site injured mice. Surprisingly, pretreated cells failed to confer the vasculoprotective effects previously observed by naive MSCs within the jejunum. Having said that, in…
Xhibit terrific protein homology. In addition, the distinctions between the findings within this paper in contrast with other published effects may be because of cross-reactivity of CCN2 antibody with yet…
MEVs regulate immune response via thesehttp://www.thno.orgDiscussionEVs are present in milk (mEVs) and play a vital part inside the development of immune technique . In this study, we comprehensively investigated the…
Of the Incarnate Word, San Antonio, TX, USA. 10Future Physicians of South Texas, San Antonio, TX, USA. 11El-Amin MMP-13 Molecular Weight Orthopaedic and Sports Medicine Institute, 2505 Newpoint Pkwy, Suite…
Rounded to 1 cm platinum needle electrodes inserted subcutaneously in the cheek and tail, respectively. We HIV drug stored acquired responses on a industrial ERG method (UTAS 3000, LKC Technologies,…
Ring the vertical growth phase bind to collagen type-1 by way of 21 and 51 integrins (Table two). This stimulates the expression of MMP-1 and -2, which are crucial for…
Ral transmembrane protease serine 2 (TMPRSS2). Both IFITM3 and TMPRSS2 incorporated into EV particles. Their incorporation needed the ESCRT machinery of EV-producing cells. Functional ESCRT machinery was also needed for…
ProTech (Rocky Hill, NJ). Monoclonal antibodies against CD3 (UCHT1), CD28 (CD28.two), CD1a (HI149), CD11c (HL3), CD14 (rmc5-3), CD16 (3G8), CD11b (M1/ 70), CD80 (L307.4) and HLA-DR (G46-6) were bought from…
Ston, Texas, USA. i ORCID ID (https://orcid.org/0000-0002-8172-0784). ii ORCID ID (https://orcid.org/0000-0003-1780-7719).Significance: Cutaneous scarring impacts millions of patients throughout the world and ends in significant fiscal and psychosocial burdens. Given the…
Volume per total volume; TbN = trabecular number; TbTh = trabecular thickness; TbSp = trabecular separation. doi:10.1371/journal.pgen.1003247.tvariation, was also connected with cortical porosity (0.15 SD raise per C allele, p…
The development of melanomas, IL-8 of endothelial origin additional promotes melanoma cell migration. In addition, tumor-derived IL-8 is in a position to induce endothelial cell migration (Figure 2). IL-8 is…
Ins. Lep(ss)-P85(L) crosses the BBB working with the leptin transporter, and exhibits improved peripheral PK along with elevated accumulation inside the brain in comparison to unmodified leptin. Lep(ss)-P85(H) also has…
Ne with 2 fetal bovine serum and blocked with mouse and human serum at 4for thirty min. For each antibody staining, cells were incubated with antibodies as described from the…
Ion of proteins with amphiphilc block copolymers . By way of example, Pluronic block copolymers (also termed "poloxamers") consist of hydrophilic poly(ethylene oxide) (PEO or PEG) and RGS19 Compound hydrophobic…
Ston, Texas, USA. i ORCID ID (https://orcid.org/0000-0002-8172-0784). ii ORCID ID (https://orcid.org/0000-0003-1780-7719).Significance: IKK-α medchemexpress Cutaneous scarring impacts numerous patients globally and leads to substantial fiscal and psychosocial burdens. Given the Bak…
Actionated radiation therapy (RT) is definitely the typical of care in HNSCC, preclinical investigations recommend that the addition of PD-1 SSTR3 custom synthesis blockade to RT could be clinically valuable.…
The altered cell survival/death response isn't enough to cause the disease and there should be other genetic or environmental aspects in determining the onset of clinical disease. The explanation for…
Tly been discovered in tissue samples of human prostate obtained by needle biopsy (45), and an integrated gene and miRNA expression evaluation of prostate cancer ssociated fibroblasts supports a prominent…
Ioblastoma patients was not completed due to the fact of extreme inflammatory reaction prior to tumor debulking . Interestingly, CED of enzyme replacement therapy showed some consistency among preclinical study…
Ne with two fetal bovine serum and blocked with mouse and human serum at 4for 30 min. For each antibody staining, cells have been incubated with antibodies as described through…
Itochondria depolarization, cytochrome c release, and caspase-3 activation (Zeng et al., 2010). Inside the present study on stroke animals, elevated caspase-3 activation was observed inside the ischemic brain at 3…
Of B cells that neutralize self-antigens arising from cell destruction, might represent a newly discovered but evolutionarily old mechanism for the prevention of autoimmunity.AcknowledgmentsThis study was supported by the Intramural…
Ion of proteins with amphiphilc block copolymers . By way of example, Pluronic block copolymers (also termed "poloxamers") consist of hydrophilic poly(ethylene oxide) (PEO or PEG) and hydrophobic poly(propylene oxide)…
Erythrinconjugated anti-CD34 (Clone 8G12; BD Biosciences, San Diego, CA) and analysed with FACSARIA.RNA extraction and quantitative reverse transcriptionpolymerase chain reactionRNA was extracted with all the Tri-reagent (MRC Inc., Cincinnati, OH)…
Hor manuscript; available in PMC 2022 June 03.Cossarizza et al.Pagea signal latest of the photodiode to a voltage (TIA). Furthermore, pre-HD1 Storage & Stability amplifiers execute operations, this kind of…
Epatocyte growth factor (HGF) inside the mediation of glandular cell migration has been hypothesized . Other "wound-healing" aspects for instance Activin A, VEGF, cysteine-rich secretory protein 3 (CRISP3), and galectin-7…
Al ailments.Insulin-like development factor-Insulin-like growth factor-1 (IGF-1) is actually a single-chain proinsulin-like polypeptide, which consists of 70 amino acids. IGF-1 is a growth hormone (GH)-dependent development element, and it truly…
T: No applicable. Acknowledgments: This work was also supported by the European Union's Horizon 2020 analysis and innovation system under the grant agreement No 857287. Conflicts of Interest: The authors…
Introduced into IR injured mice. Surprisingly, PAK6 list pretreated cells failed to confer the vasculoprotective effects previously observed by naive MSCs in the jejunum. Nonetheless, in contrast, previously nontherapeutic MSCs…
Nd foamy macrophages, and in atherosclerotic plaques it was located inside the thickened intima, but not in cholesterol-rich or calcifying areas. Within the identical study, the lumican transcript was detected…
Ave shown their efficacy in rotator cuff and Achilles tendon repair. For example, Adams et al., studied the usage of human cadaver dermis inside a canine infraspinatus injury model and…
Hen these similar mice had been immunized with Alum 5 weeks soon after reconstitution, they became extremely sick within 8 days such that the experiment had to become terminated prematurely.…
Ins. Lep(ss)-P85(L) crosses the BBB employing the 4-1BBL/CD137L Proteins Formulation leptin transporter, and exhibits improved peripheral PK along with elevated accumulation within the brain compared to unmodified leptin. Lep(ss)-P85(H) also…
S encoding the ligands to the ERBB signaling cascade and identified a selective up-regulation of amphiregulin expression, which occurred at later phases of cisplatin resistance improvement. Amphiregulin is really a…
As shown to become regulated by miR-10a, miR-17-92 cluster and miR-181a . The coordinated interplay amongst immunity regulation and IECs is crucial in controlling barrier permeability. Further details on relevant…
With prior operate demonstrating enhanced proliferative activity in IL-10R alpha Proteins Biological Activity lymphoblasts carrying the PGRN mutation c.7091-G.A . Following 72 h of serum deprivation, the number of cells…
Ents who survive the initial "hyperinflammatory" phase of sepsis go on to develop a prolonged state of "immune paralysis" and chronic inflammation (termed persistent inflammation/immunosuppression and catabolism syndrome). This delayed…
D description of your CPP internalization mechanisms, and also other properties like stability, toxicity and immunogenicity have been reviewed elsewhere . Here we focus on use of CPPs for delivery…
Erythrinconjugated anti-CD34 (Clone 8G12; BD Biosciences, San Diego, CA) and analysed with FACSARIA.RNA extraction and quantitative reverse transcriptionpolymerase chain reactionRNA was extracted using the Fc-gamma Receptor Proteins medchemexpress Tri-reagent (MRC…
D urface interfaces . Although classification systems are in location to ascertain aggregate options that confer immunogenic potential, there's an overall lack of understanding of the sort and size of…
S dorso-anterior phenotypes . CCN2 right binds bone morphogenic protein (BMP) four and TGF1 by means of its CR domain . These interactions result in inhibition of BMP4 exercise by…
Mber (Tb. N) or thickness (Tb. Th) in either Rictorf/f or RiCKO mice (Table 1). Alternatively, Scl-Ab at five or 25 mg/kg caused each mice to increase trabecular bone volume…
And PMA, the former group had more impacts, seen with all the fainter marker of your proteins than the later group. In protein analysis, actin, being a protein that was…
Terials 1) can still exploit the extracellular pathways, and two) stay active within the CNS (or in the case of the nanocarriers are released into the brain). The key problem,…
S accumulate all around the bud and kind the dental Interferon & Receptors Proteins Recombinant Proteins papilla. After the bud stage, the epithelial compartment undergoes particular folding throughout the cap…
E processes of inflammation and immune activation. Part of this network contains local immunoregulatory and immunosuppressive mechanisms, which exist to provide protection for the endogenous antigens of spermatogenesis, protection that…
Lectivity (980, 1146, 1155)), their activation and regulation are entirely different from each other. TRPM2 channels are activated by oxidative and nitrositive anxiety, resulting from in portion to a C-terminal…
Gical roles in impacting cell death, plasticity and survival. Therefore there's a possibility for off-target effects unless neurotrophins are delivered precisely to their required web sites of action. On the…
Ston, Texas, USA. i ORCID ID (https://orcid.org/0000-0002-8172-0784). ii ORCID ID (https://orcid.org/0000-0003-1780-7719).Significance: Cutaneous scarring affects countless sufferers globally and ends in considerable fiscal and psychosocial burdens. Given the immune system's intricate…
Id hormone also as peptide hormone receptors. Members of each receptor classes are critical prognostic variables in human breast cancer. Clinical information indicate that overexpression in the HER-2 gene is…
Tistically substantial improvement. Nonetheless the mixture administration was no improved than riluzole alone. Although the diameter of motor neurons was preserved on the lesion side by administration of riluzole, it…
Stained histology slides were analyzed making use of the Good Pixel Count Algorithm available with all the Aperio ImageScope computer software to determine the SMA density in the implant web-site…
Prior to gel electrophoresis and Western blotting (information not shown).Use of Chemical Inhibitors to Block Signaling PathwaysTo ascertain the function of key signaling pathways in Gap27-induced gene expression, we blocked…
Al., 1997; Huey et al., 1999). Aged ovaries also show upregulated VEGF levels most likely as an CD97 Proteins manufacturer attempt to compensate for hypoxia (Friedman et al., 1997; Klein…
Ed below and be discussed in the context of the IL-23/IL-17 paradigm of autoimmunity.Mediators of Inflammation corresponding mouse model of human RA, that IL-23 is crucial for the autoimmune inflammation…
Involved in neurodegenerative and cerebrovascular diseases and for their feasible use as clinical biomarkers. Funding: Italian Ministry of Overall health, Ricerca corrente 2017018.OWP2.03 = PS04.Microscale electrophoretic separations of exosomes Yuliya…
Rrier at the ventricle surface hindering the diffusion of substances from CSF into brain parenchyma . Indeed, the brain section of animals getting i.c.v infusion of standard FGF (bFGF) and…
Ls; interferons; T cells; NK cells1. Introduction The liver is definitely the metabolism hub of your physique, which can be accountable for all big anabolic and catabolic actions for survival.…
Ing astrocytes, through secreted extracellular vesicles (EVs). Such alterations within the GBM cells relationships with their microenvironment in response to AAT could possibly be involved in therapeutic resistance. Solutions: Human…
Nfection with HIV-1LAI/IIIB or HIV-1SF162 substantially decreased oxyradical levels by about 2-fold when compared with HCV infection alone (Fig. 4C). Exposing HCV-infected cells to morphine alone had no effect on…
N non-transformed epithelial cells. In some cell types (BT20 as an example) FoxO3 is chronically localized in the cytosol and development aspects have little or no effect. In HCC1806 or…
G neurotoxicity, endothelial cell apoptosis and inflammation , which decreased likelihood of their translation to clinic use. An additional obstacle to future item development is often a non-specific penetration of…
Ed an asymmetric staining inside the outer epithelium, which is not detected in all tissues (fig. 2e, f). These outcomes showed that CCN2 is detected preferentially from the signaling centers…
A later time, P2, TrkA-positive fibers in wild-type mice have invaded the spinal cord and are entirely restricted to their target fields within the dorsal laminae (Figure 3J, n =…
Digestion resulted in big merchandise of approximately 46 and 25 kDa (Fig. four) but only the full-length uncleaved protein plus the 25-kDa product reacted with all the polyhistidine MAb (information…
Usion, and pinocytosis . The endocytic pathway could be the principal route by which exosomes enter the cell, release the contents, and exert their biological effects. Even so, direct delivery…
Ion of proteins with amphiphilc block copolymers . One example is, Pluronic block copolymers (also termed "poloxamers") consist of hydrophilic poly(ethylene oxide) (PEO or PEG) and hydrophobic poly(propylene oxide) (PPO…
Facing of creating new remedies, as quite a few bacteria have generated resistance to antibiotics (35460), highlight the importance of creating information about MC response to the infection procedure. Animal…
Of its important part in activating EGFR-ligands 33. Interestingly, TIMP3, which is tightly related with ADAM17 in extracts from endothelial cells and inhibits ADAM17 as well as other metalloproteinases 346,…
Involved in ROS homeostasis, whilst the miR-21 inhibitor improves KRIT1 and SOD2 expressions, reduces ROS manufacturing, and ameliorates mitochondrial membrane probable in HUVECs taken care of with higher glucose (193).…
Wledge no evidence of which has been provided so far to assistance this mechanism. It was also suggested that cationic liposomes can create a transient pathologic opening of your BBB…
Etastases (12). We discovered that in ThrbPV/ PV mice, castration of female mice was connected with a lower price of thyroid cancer, and castration in male mice was linked with…
Ross-linking, decreased levels of insulin and IGF-1, and increased insulin sensitivity . The enhanced expression of PPAR and constitutive activation of some of its target genes happen to be detected…
Uthor Manuscript Author Manuscript Author ManuscriptCancer Res. Author manuscript; accessible in PMC 2016 November 15.Biktasova et al.PageColony formation of human lung cancer cells in soft agar was carried out, as…
Terials 1) can nevertheless exploit the extracellular pathways, and two) stay active within the CNS (or within the case on the nanocarriers are released into the brain). The crucial concern,…
Es that activate macrophages and preferentially polarize helper T cells toward sort 1 helper T cells (Th1s) and form 17 helper T cells (Th17s).four Style one immune IL-24 Proteins Recombinant…
Phosphorylates the Cx43's Ser368 web-site, was considerably upregulated and activated within the plasma membrane. Our final results have been related to these of a preceding immunohistochemistry study that showed ischemia-induced…
S necessary to activate Akt, Ras/Raf, Rac, c-fos, Jak/Stat, Rac, and also a host of other intracellular transducers . Upon phosphorylation by protein Cathepsin B Proteins manufacturer tyrosine kinases, Gab2…
Ion of proteins with amphiphilc block copolymers . For example, Pluronic block copolymers (also termed "poloxamers") consist of hydrophilic poly(ethylene oxide) (PEO or PEG) and hydrophobic poly(propylene oxide) (PPO or…
Ding EGF-like ligand, NRG1, NRG2, NRG3, NRG4, and transforming development factor- gene expression. We detected a transient induction of amphiregulin gene expression in response to cisplatin publicity in the 1and…
T NIH-PA Author Manuscript NIH-PA Author Manuscript3.4 NFB binds for the jagged-1 promoter To determine whether NFB proteins can bind to KIR3DL1 Proteins custom synthesis sequences inside the jagged-1 promoter…
Freshly prepared SmGM medium. Cells have been harvested at 0h (30h starvation time point), 12h, 15h, 18h, 24h and 30h just after releasing and simultaneously processed for cell cycle evaluation…
Ion of proteins with amphiphilc block copolymers . For instance, Pluronic block copolymers (also termed "IgE Proteins site poloxamers") consist of hydrophilic poly(ethylene oxide) (PEO or PEG) and hydrophobic poly(propylene…
Ne with two fetal bovine serum and blocked with mouse and human serum at 4for 30 min. For each antibody staining, cells were incubated with antibodies as described by the…
Cesses, inhibition of catabolic pathways Regulation of Ca2+ -dependent mechanisms and regenerative processes Thermogenesis, glucose homeostasis, mitogenesis Regulation by Physical Physical exercise Modulation by Muscle Aging Feasible Effects on Muscle…
D EMBL Protocadherin-1 Proteins manufacturer single-cell trainings courses on single cell omics technologies . Testing regardless of whether the sort-stream hits the center of test tubes and microtiter plates is…
Eceptor antagonist CCX832 but not by an IGF receptor tyrosine kinase inhibitor AG1024; conversely, the response to IGF-II was inhibited by AG1024 but not CCX832 (Fig 1A). The response was…
He 10k xg supernatant prior to applying the sample on the gradient. Protein and particle concentrations and ratios, morphology and protein markers had been examined by single particle tracking (ParticleMetrix),…
It seems that LC-ESI-MS/MS of serum/plasma has revealed a total of 12,130 proteins detected with no less than 1 unique or characteristic peptide not identified in any other sequence and…
Arious T cell subsets to this method. Because the IL-33 Proteins Molecular Weight immune system's involvement in wound healing has come to your forefront of standard wound healing investigate, this…
Ng the vesicles . Within this study we use the term exosome to refer to each of the extracellular vesicles isolated utilizing our described techniques and identified to be inside…
Ion of proteins with amphiphilc block copolymers . By way of example, Pluronic block copolymers (also termed "poloxamers") consist of hydrophilic poly(ethylene oxide) (PEO or PEG) and hydrophobic poly(propylene oxide)…
Sely linked to your strength and duration of cytokine, Notch and TCR signalling, the expression levels of various regulatory things within the different progenitors may perhaps contribute to their different…
Ake by captured pictures, cells have been exposed to either 0.5 M EthBr or 500 M 2-NBDG (Invitrogen, Eugene, OR) for 10 min at 37 . Then, cells were washed…
N SEM, P 0.001 significantly longer neurites compared with control cultures. n.s isn't considerably differentOur outcomes showed that the exosomes isolated from SCs and dADSCs, contained messenger and microRNAs which…
Rtue of its C-terminal cytoplasmic tail. TRAFs 1, two, 3, and five Growth Differentiation Factor 5 (GDF-5) Proteins medchemexpress associate with CTAR1 of LMP1 and activate non-canonical NF-B signaling, major…
Expression profiles related with muscle aging and age-related cardiac dysfunction . The compound protects mice against diet-induced obesity along with the associated insulin resistance via enhanced mitochondrial function mediated by…
Progressive release of their items, are described in a diversity of cell sorts . In human eosinophils, it's recognized that the amount of emptying Influenza Non-Structural Protein 1 Proteins custom…
Icantly larger response rate and superior prognosis; such a CD3d Proteins web predictive power was not observed with carcinoembryonic antigen or CA-19.9 levels. A current study showed that high pretreatment…
Rrhage. Transl Stroke Res 2015; 6: 33941. 21. Chen S, Yang Q, Chen G, et al. An update on inflammation in the acute phase of intracerebral hemorrhage. Transl Stroke Res…
Te spermatogenesis and Sertoli cell functions, such as secretion of your protein hormone, inhibin.77 In turn, testosterone and inhibin operate via a negative feedback loop to regulate LH and FSH…
Are presented in Table 1. The absolute magnitude of fold regulation P-Cadherin/Cadherin-3 Proteins custom synthesis detected with RT-PCR approach was always equivalent or greater than the fold transform detected by…
D if EVs isolated from BMSCs stimulated macrophage polarization . In this case, in certainly one of the experimental groups, BMSCs were taken care of with siRNA, which silenced the…
D description of the CPP internalization mechanisms, along with other properties for example stability, toxicity and immunogenicity have been reviewed elsewhere . Right here we concentrate on use of CPPs…
Ding EGF-like ligand, NRG1, NRG2, NRG3, NRG4, and transforming development factor- gene expression. We detected a transient induction of Dendritic Cell CD Proteins medchemexpress amphiregulin gene expression in response to…
Chniques like antibody-based magnetic good or negative choice are applied to improve sensitivity of detection. For that quantification of tumor cells, the direct or indirect staining protocol outlined in Area…
S strongly retarded by active RhoA (Fig. two).101,102 Also patients suffering from Alzheimer's disease might sooner or later profit from a downregulation from the RhoA/ROCK pathway.103 A cell-penetrating variant of…
G neurotoxicity, endothelial cell apoptosis and inflammation , which decreased likelihood of their translation to clinic use. One more obstacle to future product development can be a non-specific penetration of…
Rence was observed in exosome isolates from plasma for total tau and phosphorylated tau.protein that is definitely also the supply of A following cleavage by -secretase. It was previously shown…
Within the non-drinker group). Amongst smokers, the typical number of cigarettes consumed every single day was 12.0. The average number of units of alcohol drunk each week by typical shoppers…
Rrhage. Transl Stroke Res 2015; six: 33941. 21. Chen S, Yang Q, Chen G, et al. An update on irritation within the acute phase of intracerebral hemorrhage. Transl Stroke Res…
Mmune cell infiltrates in infertile guys.four,5,22,23,229,318,3 20,372,432,627 What is the actual physiological relevance of these experimental and clinical observations, and what may possibly this imply for understanding the effects of…
Ssion and infiltrating B cell (or DC) levels Tumor-infiltrating lymphocytes, which are identified as an independent predictor of survival, possess the prospective to affect cancer prognosis . As a result,…
Ion with CM2D and CM3D. Data are proven as percentage of control (Crtl) and as mean normal error from the indicate; n = three. (F) Elastin manufacturing by HaCaT and…
Rrier at the ventricle surface hindering the diffusion of substances from CSF into brain parenchyma . Indeed, the brain section of animals receiving i.c.v infusion of fundamental FGF (bFGF) and…
Rrhage. Transl Stroke Res 2015; six: 33941. 21. Chen S, Yang Q, Chen G, et al. An update on irritation from the acute phase of intracerebral hemorrhage. Transl Stroke Res…
Phosphoprotein. The virus consists of a lipid bilayer that Ubiquitin-Specific Peptidase 45 Proteins Accession anchors the membrane (M), envelope (E) and spike (S) proteins. A subset of coronaviruses possess a…
Nalization of big aggregates formed by PepL is probably on account of phagocytic uptake. PepL Disaggregation in Endosomes Is Linked with Endosomal Swelling--Once internalized, the particles formed vesicles of irregular…
H the genetic cargo and the donor and recipient species on the price of vesicle-mediated gene exchange. Therefore, we look in the genetic and biophysical controls of EV production, DNA…
Tment with upadacitinib normalizes essential pathways associated with RA pathobiology, like IL-1, IL6, IFN, and TNF. Upadacitinib can also be connected with leukocyte activity, which includes cell migration and inflammatory…
Ly the cell pellet. 27.Repeat phase 26 two additional occasions. 28.Add straight to the cell suspension a hundred L of warm Amp Combine and mix gently by short vortex. 29.Incubate…
L aiming to provide definite proof of necroptosis would must unequivocally demonstrate the look of one particular or extra of these biomarkers. Regrettably, none of at present available protocols fulfills…
With very smaller pores by interdigitating neighboring foot processes that ultimately present efficient size-based permselectivity. Nonetheless, its charge selectivity for plasma proteins really should not be overlooked as apical membrane…
Introduced into IR injured mice. Surprisingly, pretreated cells failed to confer the vasculoprotective effects NTB-A Proteins manufacturer previously observed by naive MSCs within the jejunum. Having said that, in contrast,…
To apoptosis within the absence of serum. In each LI-Cadherin/Cadherin-17 Proteins web situations, CDK6 inhibitors decreased the levels of phosphoryla-tion of pRb protein in c.709-1G.A carrier cells to reach these…
E signal supplies further regulatory opportunities by means of modulating signal production (transcription and translation), signaling transport and availability through binding to extracellular matrix proteins, and signal activity by means…
Cytes (CTLs), but they have contrasting tolerogenic functions in the skin . LCs suppress speak to hypersensitivity by interaction with cognate CD4+ T cells in the context of IL-10 .…
Ne with two fetal bovine serum and blocked with mouse and human serum at 4for 30 min. For each antibody staining, cells were incubated with antibodies as described through the…
Ston, Texas, USA. i ORCID ID (https://orcid.org/0000-0002-8172-0784). ii ORCID ID (https://orcid.org/0000-0003-1780-7719).Significance: Cutaneous scarring influences numerous patients globally and ends in major money and psychosocial burdens. Given the immune system's intricate…
By approaches relying on intravenous injection (i.v.) of EV isolated in vitro. Employing human tumour cells making GFP-labelled EV, we've got examined the capture of tumour-derived EV in distant organs…
S also an important parameter for antibacterial activity. Tang et al. investigated the antibacterial activity of one more chitosan derivative, argininefunctionalized chitosan, around the Gram-negative bacteria Pseudomonas fluorescens and E.…
For MMP-2 (26), and galectin-3 is cleaved by MMP-14, -2, and -9 (84, 85, 134). Right here, candidate Cystatin-2 Proteins web substrates were identified from a cellular atmosphere, which supports…
Ated that gastrointestinal epithelium-derived exosomes carry AMPs, which includes hBD-2 and cathelicidin-27 to participate in luminal defense systems against microbial pathogens (Hu et al., 2013).Frontiers in Cell and Developmental Biology…
E ischemic heart was obviously reduced, suggesting an enhanced risk of mortality with cardiac rupture. These findings indicate that FSTL1 could stimulate the activation of fibroblasts and protect against cardiac…
The SC fat layer includes nerves, blood vessels, and lymphatic vessels, along with adipocytes that sequester potentially inflammatory lipids and produce proinflammatory cytokines upon stimulation . Adipose tissue is separated…
Receptor was performed. The MII rate (Grp A-24h-70 , 48h-80 , 74h85), blastocyst price (A-40 , B-23 , C-23), and CC LH receptor mRNA expression levels were larger in group…
Lation pathway is usually induced by PEVs transferring P-selectin, which triggers TF on monocyte membrane upon PSGL-1 binding. Alternatively, TF could be launched by salivary and monocyte-derived EVs. exposure on…
Elets by means of P-selectin binding.35 We focused on the content material and possible release of cytokines, chemokines, and growth factors from activated platelets. Thrombin-induced degranulation of washed platelets reveals…
Ng also distant uninvolved skin, and other tissues or organs . This reviewInt. J. Mol. Sci. 2018, 19,3 ofbloodstream affecting also distant uninvolved skin, as well as other tissues or…
Pending around the frequency of target cells for different CVs.Author Manuscript Author Manuscript Writer Manuscript Author ManuscriptEur J Immunol. Writer manuscript; offered in PMC 2022 June 03.Cossarizza et al.PageAuthor Manuscript…
Nts were performed at the very least 3 occasions with similar benefits, except where indicated.NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript3. RESULTS3.1 TNF- induces SARS-CoV-2 Spike Proteins MedChemExpress…
To DNA demethylation remedy differentially in various immune cell kinds. To check this see, we handled splenocytes with 5-aza-CdR plus Con A stimulation for 72 hours first, then purified CD4+…
E Fig. seven illustration). All of the cells expressed large levels of CD7, a receptor expressed in early T cells (data not shown). Our benefits indicate that the FT-derived CD34+…
Ults are constant using the thought that GFs not potential of cell divisions, it remained undetermined to what extent only stimulated proliferation of endogenous NPCs, but additionally proGFP /GFAP cells…
Antibodies as a control, and after that incubated at four . Cells were washed 3 times in PBS containing five FBS and incubated with anti-mouse IgG labeled with FITC for…
Ntact Gly m 4 allergen (Table 1). Cell cultures had been kept in CO2 -incubator (5 CO2 , 37 C) for 24 h. Culture supernatants from the 96-well plate and…
E epidermis was separated from tissues employing sterile forceps, and then digested with 0.125 trypsin (Gibco, Life Technologies, Carlsbad, CA, USA) for 15 min at 37 . The samples were…
D description on the CPP internalization mechanisms, as well as other properties for instance stability, toxicity and immunogenicity had been reviewed elsewhere . Here we concentrate on use of CPPs…
Conditions. Tgm1+/ ice using a C57BL/6 background have been intercrossed to produce Tgm1 ice. Primers MhomoU (5'-GGGAATGCTGGTTGTGACTGGTGTGGAT-3') and L972-2 (5'-GCGTAGGTTTAGG TTGTGTCCGTTGTTCTTAG-3') had been employed for genotyping of Tgm1 ice. For…
Icle tracking evaluation of EVs from CD63 CRISPR cells demonstrated a substantial lower in relative particle secretion. Similarly, decreases in vesicle secretion have been found following GW4869 therapy. Immunoblotting of…
Ase-1. Indeed, N-terminal processing of ALK-7 Proteins Biological Activity IL-1F7b by caspase-1 was reported and only mature IL-1F7b showed important affinity to an IL-18R :Fc fusion protein (14).Bufler et al.Fig.…
Utralizing dose (ND50). 2.2 Cloning, and evaluation of jagged1 promoter sequence Genomic DNA was isolated from HUVEC by typical protocol. Utilizing the GenBank sequence for human chromosome 20 as a…
In the BBB becomes vital to ensure physiological effect . Lysosomal enzymes represent a further important category of proteins that have to be delivered towards the brain for remedy of…
Ston, Texas, USA. i ORCID ID (https://orcid.org/0000-0002-8172-0784). ii ORCID ID (https://orcid.org/0000-0003-1780-7719).Significance: Cutaneous scarring has an effect on millions of individuals throughout the world and ends in substantial economic and psychosocial…
Of BTNL2 downregulates (42.9) greater than it upregulates (28.6) 21 LIUS-upregulated genes. Moreover, BTNL2 upregulates (23.five) more than it downregulates (17.six) 17 LIUS-downregulated genes. ese outcomes recommend that BTNL2 overexpression…
Wanted to go one-step further and quantify variations inside the L-PRF secretome over time. For that purpose, new membranes from four unique Caspase-4 Proteins supplier donors were collected and cultured…
D description from the CPP internalization mechanisms, and also other properties which include stability, toxicity and immunogenicity have been reviewed elsewhere . Right here we concentrate on use of CPPs…
Ed skin and it is induced during the proliferation of keratinocytes . However, WFDC12 can be a member from the whey acidic protein (WAP) family members and WFDC12 ranges in…
Ion need patient and/or parent compliance, pose challenges controlling the vector of movement, may well fail to kind a uniform bone regenerate, could create infection or inflammation from the distraction…
Lyses have been performed utilizing SPSS Statistics version 26.0 (SPSS Inc., Chicago, IL, US) and GraphPad Prism 8.0 (GraphPad Software, Inc., CA, US). Differences in demographic and clinical traits involving…
Last differentiation and bone loss. Osteoclast-mediated bone resorption then releases variables for example calcium, TGF-, IGF-1 and FGFs that favor tumor proliferation and augment PTHrP production. In addition, PTHrP may…
O be mediated by blocking the Fc alpha/mu Receptor Proteins custom synthesis function of heat-shock protein 90 due to HDAC6 inhibition . Xie et al. made an MM cell line,…
Llular permeability maximize.178 Activation of PAR-2 by mast cell tryptase can be causative of stress-induced epithelial barrier dysfunction from the esophagus.179 In epithelial MDCK cells, PAR-2 localizes in the lateral…
R maximize for the duration of chest closure with the conclusion on the surgical treatment. Summary/Conclusion: Our data present that cooling can reduce exosome levels in blood, while complete physique…
Situations. Tgm1+/ ice by using a C57BL/6 background were intercrossed to create Tgm1 ice. Primers MhomoU (5'-GGGAATGCTGGTTGTGACTGGTGTGGAT-3') and L972-2 (5'-GCGTAGGTTTAGG TTGTGTCCGTTGTTCTTAG-3') were utilised for genotyping of Tgm1 ice. For sampling…
Of calcitonin . Yu et al. have created a glucose-responsive microsphere that may be utilised as an productive insulin carrier for oral delivery, and resulted in sustained hypoglycemic result .…
Uld be taken in interpretation of obtained final results, as, as an example, results from TEPs may originate from co-isolated substantial tdEVs, and ccfDNA may originate from DNA enclosed in…
Period animals.679 On balance, on the other hand, the published information look to indicate that resting testicular macrophages possess a good or trophic impact on Leydig cell steroidogenesis. Testicular macrophages…
E macrophage infiltration and inflammation of adipose tissues. The study demonstrated that adropin regulates the anti-inflammatory or proinflammatory phenotypes of macrophages by up-regulating the expression of PPAR- . Even though,…
He total protein lists might be observed in S2 Table as well as enriched protein lists in S3 Table. Only the prime 150 proteins enriched all over Ocln and Cldn4…
D description on the CPP internalization mechanisms, as well as other properties which include stability, toxicity and immunogenicity were reviewed elsewhere . Right here we concentrate on use of CPPs…
S accumulate all around the bud and form the dental papilla. After the bud stage, the epithelial compartment undergoes particular folding through the cap (E14.5) and bell stage (E15.five) .…
D description with the CPP internalization mechanisms, and other properties like stability, toxicity and immunogenicity were reviewed elsewhere . Right here we concentrate on use of CPPs for delivery of…
L pathological processes, for example, in EVs generated by cancer cells (11). Since the initially descriptions of a procoagulant factor in plasma (two,3), speculation about the significance of EVs throughout…
Tured cells as well as in the leukemia samples Chromosome changes were observed in a few of the cell cultures at the same time as in some leukemia samples, but…
It truly is likely that epithelial cell cohesion is comparatively weak, and that much on the cohesion of your PBs is of mesodermal origin. Indeed, when mesenchymal cells have been…
Ortium for Frontotemporal Dementia (L.G.), NIH (1R01AG036884 and R01AG030207 to L.G.), S.D Bechtel Jr. Foundation, and NIH/NCRR CO6 RRO18928 (a facility grant to J. David Gladstone Institutes). S.S.M. is supported…
Ding EGF-like ligand, NRG1, NRG2, NRG3, NRG4, and transforming growth factor- gene expression. We detected a transient induction of amphiregulin gene Hydroxyflutamide Antagonist expression in response to cisplatin publicity during…
St activation . If MSC-derived NO is mediating improvements in vascular tone following IR injury, this effect would probably be observed at later time points, as noticed inside the ileum…
Lay a part in airway inflammation and alternative activation of macrophages have not however been determined. Within this study, we applied STAT6 and IL-4Ra deficient mice on a RAG2-/- background…
Ation of gene expression in guinea pig paraflocculus soon after induction of hearing loss. F1000Research. 2014;3(0):63. one hundred. Fernandes AC, et al. Lowered synaptic vesicle protein degradation at lysosomes curbs…
Realized therapeutic value for bone formation.FUTURE DIRECTIONSThough osteogenic Carboxypeptidase B2 Proteins Source factor saturated scaffolds have confirmed to be beneficial, they're restricted to local actions on surrounding cells. In situations…
Cription or mobilization, we examined total CD11b in PMN by immunoblot analysis of complete cell extracts. The complete level of CD11b remained unchanged in PMN both with or without HB-EGF…
Dose dependent and confirm the ultimate doses for induction. Immunofluorescence Lymphotoxin β Receptor Proteins Storage & Stability staining and analysis of transmission electron microscopy Immunofluorescence was performed on the cells…
Erum and mononuclear cells had been removed and saved for further evaluation. Erythrocytes had been removed by hypotonic lysis and then eosinophils were negatively selected making use of anti-CD16 immunomagnetic…
N, DC dendritic cell, ECM extracellular matrix, LC Langerhans cell, LN lymph node, mAb monoclonal antibody, SC subcutaneousIgG oligomers generated beneath process- or pH-related strain conditions had been immunogenic in…
Innate immunity and how do innate immune pathways which include IFNs can shape the subsequent improvement of an adaptive immune responseAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptIs it probable…
Tralizing antibody (Ab) inhibited the elevation of airway resistance, airway inflammation, and a rise in airway wall thickening, indicating that inhibition of IGF-I signaling may well be a promising therapeutic…
Tudy, MSC have been shown to provide a protective impact on proximal tubular cell proliferation. This effect was mediated by IGF-1.24 A limitation of systemic infusion of stem cells is…
S activator of canonical WNT in these cells, as indicated by the information in Fig.VOLUME 289 Quantity ten MARCH 7,6902 JOURNAL OF BIOLOGICAL CHEMISTRYWNT Activation by WISPFIGURE two. WISP2 activates…
Introduced into IR injured mice. Surprisingly, pretreated cells failed to confer the vasculoprotective effects previously observed by naive MSCs within the jejunum. However, in contrast, previously nontherapeutic MSCs decreased ileal…
Xhibit great protein homology. Additionally, the differences in between the findings on this paper in contrast with other published results can be resulting from cross-reactivity of CCN2 antibody with a…
Al Pharmacology Division, Health-related University, Zaporozhye, Ukraine; 3Private Hospital VitaCenter, Zaporozhye, UkrainePS05.Acoustic trapping of microparticles and its application in measuring the impact of bilberry powder consumption on plasma microparticles in…
Geometry and the worldwide membrane curvature; lipid-packing defects arise from a mismatch among these components, leading to transient low-density regions in 1 leaflet of a lipid bilayer. Amphipathic -helices containing…
Intercellular channels opened beneath enhanced interstitial pressureN. L. Jarvi, S. V. Balu-Iyer. Protein will traffic through lymphatic capillaries and pass into lymph vessels draining into nearby lymph nodes, at some…
Eagent B (Fix PERM Cell Fixation and Permeabilization Kit, Nordic-MUbio). Add mAbs for intracellular staining: 3 L kappa light chain (APC, TB28, BD Biosciences) and three L lambda light chain…
Icient for Nur77, specifically in cardiomyocytes (CM-KO mice), myocardial thinning/rupture did not happen upon chronic ISO infusion (Figure 1A), suggesting a significant function for cardiac fibroblasts (CFs) within the fibrotic…
Vantage of the structural versatility of this kind of polymer.NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript6. Particle-based carriers for CNS LAMP3/CD63 Proteins MedChemExpress delivery of proteinsNumerous studies have…
Ding EGF-like ligand, NRG1, NRG2, NRG3, NRG4, and transforming development FcRn Proteins Formulation factor- gene expression. We detected a transient induction of amphiregulin gene expression in response to cisplatin exposure…
Cessing. All donors were patients on the University of Debrecen, Faculty of Dentistry. Consecutive patients with diagnosed OSCC had been recruited into the study. Age-matched OX40 Ligand Proteins web controls…
D to produce therapeutic proteins (14). Compared to development element delivery, gene delivery is advantageous in its long-term effect too as somewhat low expense, which tends to make it promising…
Ion of proteins with amphiphilc block copolymers . One example is, CD66e/CEACAM5 Proteins Storage & Stability Pluronic block copolymers (also termed "poloxamers") consist of hydrophilic poly(ethylene oxide) (PEO or PEG)…
Because they have the likely to act as conductors with the symphony of your cellular response to damage and can nudge the general balance of inflammatory and fibrotic factors in…
Terials 1) can nevertheless exploit the extracellular pathways, and two) stay active inside the CNS (or within the case on the nanocarriers are released into the brain). The key situation,…
Infancy. Mutations from the transglutaminase one gene (TGM1), which encodes transglutaminase one (TGM1), are most commonly identified in these key and small subtypes of ARCI . TGM1 is really a…
Sma, Western blot analysis of retina extracts and FACS analysis was performed as described 17, 18, 20.ResultsCharacterization of Adam17flox/flox/Tie2-Cre mice So that you can assess irrespective of whether ADAM17 features…
Al Oncology, University of Colorado Well being Sciences Center, Box B171, 4200 East Ninth Avenue, Denver, CO 80262, USAAbstract SEMA3F, isolated from a 3p21.3 deletion, has antitumor activity in transfected…
Terials 1) can still exploit the extracellular pathways, and 2) remain active inside the CNS (or inside the case of your nanocarriers are released in to the brain). The key…
Ssarizza et al.Pagecompensation. The application over the Amnisinstruments (INSPIRE) plus the evaluation application (Thoughts) the two compensate successfully; having said that, fluorochromes requiring little or no compensation ought to be…
HedCancers 2021, 13,13 ofAuthor Contributions: Conceptualization and methodology, C.P. and D.C.HedCancers 2021, 13,13 ofAuthor Contributions: Conceptualization and methodology, C.P. and D.C.; investigation, E.C., M.G. and S.Z.; information curation and writing--original…
H unknown, having said that the upper bound of the second derivative dH unknown, even so the upper bound in the second derivative d2 is known, k (t) can be…
: 41.67 ; NS: 183.33 , p 0.05). The The VGB group hadhad fewer rats with SRS: 41.67 ; NS: 183.33 , p 0.05). The The VGB group hadhad fewer…
Utilization of f ik following the adaptation requires t spot andUtilization of f ik immediately after the adaptation requires t place and just before receiving additional session requests. Recall that…
Fillets and portions had been packed in PE-bags and thawed overnight inFillets and portions have been packed in PE-bags and thawed overnight in air at 5 C just before evaluation.…
Nly employed in bipolar and unipolar depressive disorder, works through theNly employed in bipolar and unipolar depressive disorder, works via the inhibition with the overactivated PLA2 inside the brain .…
N text mining . This research IL-20 Receptor Proteins Purity & Documentation showed the current trends in scientificN text mining . This study showed the recent trends in scientific exploration…
Wn adipocyte cell lines, albeit at significantly lower levels than inWn adipocyte cell lines, albeit at much reduced levels than in white adipocytes . Most studies examining the activation of…
S described in Materials and and Techniques. (A) Photos of invadipodiaS described in Materials and and Strategies. (A) Pictures of invadipodia cell lines. lines. (B) The DAPI as described in…
(G.S.d.R.)Citation: Raupp, N.; Val io Filho, A.(G.S.d.R.)Citation: Raupp, N.; Val io Filho, A.; Arim, A.L.; Muniz, A.R.C.; da Rosa, G.S. Development and Characterization of Activated Carbon from Olive Pomace: Experimental…
) had been utilized to examine and determine FAMEs in samples. Information have been) have been made use of to compare and identify FAMEs in samples. Information have been represented…
Of BHSIMs with configurations distinct configurations of soft and tough phasesOf BHSIMs with configurations distinct configurations of soft and tough phases have been measured on a micro-tribotester. coefficient be measured…
Pectively. The presence of tion temperature decreased within the composite scaffoldsPectively. The presence of tion temperature decreased in the composite scaffolds, indicating thevibration on the silanol silanol is indicated with…
-ln(1-Xt))-0.six -1.-0.6 -1.-0.2 -0.41 43 45 47-0.two -0.41 43 45 47--ln(1-Xt))-0.6 -1.-0.6 -1.-0.2 -0.41 43 45 47-0.two -0.41 43 45 47-1.4 -0.two 0.0 0.two 0.4 0.6 0.eight 1.0 1.2 1.4…
E on clothing as in comparison to other costs, mostly because itE on clothing as in comparison to other expenditures, primarily because it is fashionable (it is actually what is…
Numerous resolutions (Table 7 and Figure 9). 9). ences at several resolutions (Table 7 andVarious resolutions (Table 7 and Figure 9). 9). ences at different resolutions (Table 7 and Figured…
Iple regression model. Due to the fact independent observations represent certainly one of the assumptionsIple regression model. Given that independent observations represent among the assumptions for linear regression models, mean…
F 3,4-BHOT A three-necked round bottom flask was outfitted with SoxhletF three,4-BHOT A three-necked round bottom flask was outfitted with Soxhlet extractor charged with activated 4 molecular sieves, high efficiency…
Get a deeper insight and understanding of these aspects.Author ContributionsGet a deeper insight and understanding of those aspects.Author Contributions: Conceptualization, D.B. and M.A.; methodology, M.N.A. and M.A.; software program, M.N.A.;…
PV method model.Clean Technol. 2021,-Model from the battery: The batteryPV method model.Clean Technol. 2021,-Model with the battery: The battery is utilised to shop excess energy in the PV program 814…
Rythrocytes is that only a sample of blood is necessary toRythrocytes is the fact that only a sample of blood is necessary to perform the smears. Within the present work,…
Olesoxime manufacturer configurations eight 4 and four eight have the same number of cores, however the formerConfigurations 8 4 and four 8 possess the very same quantity of cores, however…
The RD and TD (transverse to RD) axes of symmetry. InThe RD and TD (transverse to RD) axes of symmetry. Within this way, the following relations for C33 , C44…
Observed that for the not superior academic level category relative toObserved that for the not superior academic level category relative for the superior academic level reference category, the lower order…
Mprovement. This is F508del in by the observation that inflammationMprovement. This really is F508del in by the observation that inflammation enhancesof F508del maycapacity , which one particular allele , we…
, mmHg Diastolic blood pressure (SD), mmHg Smoking status Current Ex Never ever, mmHg Diastolic blood pressure (SD), mmHg Smoking status Existing Ex Under no circumstances Alcohol FAUC 365 In…
In the Basilicata area (hereafter named: Antalis_BA); and (iii)(iiiInside the Basilicata region (hereafter named: Antalis_BA); and (iii)(iii) cv. Antalis, grown in grown in the Basilicata area (hereafter named: Antalis_BA); and…
29 7.eight 0.12 A5 259 three.9 0.12 A6 246 four.1 0.13 A7 492 two.0 0.13 A8 140 7.1 0.Future Net 2021, 13,16 of120 A1 - (13,eight)Quantity of29 7.8 0.12 A5…
D to obtain the advantageous effects on quality by freezing whilstD to get the advantageous effects on high quality by freezing whilst the fish are GS-626510 Autophagy Inside the pre-rigor…
D duration on the CSA-131 released from impregnated VPs had been observedD duration with the CSA-131 released from impregnated VPs were observed for 24 h. The price was almost linear…
Tly related to land-sparing or land-sharing approaches, a debate that'sTly related to land-sparing or land-sharing approaches, a debate that is definitely far from getting closed . The multifunctionality paradigm competes…
S was obtained with MAP. In 100 CO2 , shelf-life was extended byS was obtained with MAP. In 100 CO2 , shelf-life was extended by two to three days. Shelf…
S-track directions, respectively. In addition, the Compound 48/80 Cancer reference orbit derived by the uniqueS-track directions, respectively. Moreover, the reference orbit derived by the various ECOM models was assessed by…
Lack circle the CCGaV-Weihai isolate from Malus domestica in China.inLack circle the CCGaV-Weihai isolate from Malus domestica in China.in China.To additional establish the connection among diverse CCGaV isolates, the pairwise…
To time. The intermolecular visualization in the MD snapshots taken throughoutTo time. The intermolecular visualization from the MD snapshots taken through the latter interval of simulation indicated that the plumbagin…
Erceived satisfaction is observed as an evaluation by comparing expectations andErceived satisfaction is observed as an evaluation by comparing expectations and actual knowledge of solutions or solutions . The service…
; and infant gender (except in model stratified by infant gender).Toxins; and infant gender (except in model stratified by infant gender).Toxins 2021, 13,10 ofWhen we excluded participants with abnormal liver…
Ents needs to be according to the foundations proposed in uniqueEnts demands to be based on the foundations proposed in distinctive regions including psychology, neuroscience, and behavioral economics. Nonetheless, not…
Utilization of f ik soon after the adaptation takes t place andUtilization of f ik following the adaptation requires t location and ahead of receiving additional session requests. Recall that…
D diet regime might cause imbalanced nutrition . Hence, the threat elementsD diet may possibly lead to imbalanced nutrition . As a result, the danger elements including expense standard, taste,…
( R - R) N (0, R ) two ^ where R = B T I -( R - R) N (0, R ) 2 ^ where R = B…
Ethanol's metabolic pathway. In alcohol-related research carried out amongst the mid-Ethanol's metabolic pathway. In alcohol-related research carried out between the mid-1980s and 1990s it was shown that GTN and ISDM,…
29 7.8 0.12 A5 259 3.9 0.12 A6 246 4.1 0.13 A7 492 2.0 0.13 A8 140 7.1 0.Future World-wide-web 2021, 13,16 of120 A1 - (13,eight)Quantity of29 7.eight 0.12 A5…
Gy and speech therapy teachers' help. Individualized curricular adaptationGross motor developmentFineGy and speech therapy teachers' assistance. Individualized curricular adaptationGross motor developmentFine motor developmentSocial and adaptive developmentLanguage and communication improvement Sensory…
Ion exchange phenomenon exactly where sodium ions, adsorbed around the geological suppliesIon exchange phenomenon exactly where sodium ions, adsorbed on the geological materials constituting the subsoil, are Goralatide TFA desorbed…
Onsistently assistance the position that terrorists are rational actors and thatOnsistently assistance the position that terrorists are rational actors and that their decision creating follows an inherent logic . The…
Lating the number of DPSs to become allocated to individual PRUsLating the number of DPSs to be allocated to person PRUs, and determining the charging priority for individual PRUs. Right…
Research have now demonstrated that the transient delivery of DNA methylationResearch have now demonstrated that the transient delivery of DNA methylation editing systems outcomes in stable modifications in methylation for…
Mn TWIP steel deformed by cold rolling and recrystallized by annealingMn TWIP steel deformed by cold rolling and recrystallized by annealing and assess the evolution of anisotropy. In this way,…
Not possible to carry them out, hence specialised workshops The as a result ofImpossible to carry them out, therefore specialised workshops The due to very best evaluation was given towards…
Ncentration also impacts the line profile of surface measures. The AFMNcentration also impacts the line profile of surface measures. The AFM images shown in Figure four indicate that the meandering…
Ium in onion which was not detected at 17.5 years soon after theIum in onion which was not detected at 17.5 years immediately after the get started of your experiment…
Ction in shelf life . To attain the most effective attainable market place qualityCtion in shelf life . To attain the most effective achievable marketplace top quality, it really is…
Distances is larger for H3 than H1, giving a improved differentiationDistances is bigger for H3 than H1, giving a improved differentiation amongst partitions. When using the H1 metric, we obtain…
, like dendritic cells. When the allergen is diffused, extreme anaphylaxis, which include dendritic cells. When the allergen is diffused, extreme anaphylaxis will occur. Therefore, to achieve effective vaccines, allergen…
Puted concurrently; intra-FM: a number of pixels of a single output FM arePuted concurrently; intra-FM: multiple pixels of a single output FM are processed concurrently; inter-FM: various output FM are…
Vity, proteins are denatured and shed their original conformation, releasing sequencesVity, proteins are denatured and shed their original conformation, releasing sequences of compact peptides studied for their prospective health-related effects.…
[email protected] Tsubota GSK2646264 Purity & Documentation Laboratory, Inc., Tokyo 160-0016, Japan; [email protected] Tsubota Laboratory, Inc., Tokyo 160-0016, Japan; [email protected] Correspondence: [email protected] (Y.T.); [email protected] (T.K.); Tel.: 1-617-919-2533 (Y.T.); 81-3-5636-3204 (T.K.)Citation: Lee,…
Puted concurrently; intra-FM: multiple pixels of a single output FM arePuted concurrently; intra-FM: several pixels of a single output FM are processed concurrently; inter-FM: various output FM are processed concurrently.Distinctive…
T-2 triolT-2, T-2 triol NEO, T-2NEO, NEOHT-2, and T-2 tetraolNEOT-2 triolT-2, T-2 triol NEO, T-2NEO, NEOHT-2, and T-2 tetraolNEO mixtures, which possibly stem from the much less toxic toxins that…
Puted concurrently; intra-FM: a number of pixels of a single output FM arePuted concurrently; intra-FM: numerous pixels of a single output FM are processed concurrently; inter-FM: several output FM are…
Period (Table 3). Thus, it was speculated that the lack of helpfulPeriod (Table three). For that reason, it was speculated that the lack of useful effects of workout and supplements…
, = up xd two yd two (24) (23)Assumption three. The best heading angle d given by, = up xd two yd two (24) (23)Assumption three. The ideal heading angle…
Had access to real-world information set limited to a five-day trace.Had access to real-world data set limited to a five-day trace. Consequently, the algorithms presented within this function have been…
On aids to decrease Thromboxane B2 custom synthesis sleeps disorders, depression, tension, and anxiety, as a resultOn helps to decrease sleeps disorders, depression, anxiety, and anxiousness, as a result growing…
Period (Table 3). Hence, it was speculated that the lack of effectivePeriod (Table 3). For that reason, it was speculated that the lack of valuable effects of physical exercise and…
Model, the Tocantins-Araguaia River Basin was subdivided in 22 sub-basins (Figure 1) accordingModel, the Tocantins-Araguaia River Basin was subdivided in 22 sub-basins (Figure 1) in line with the streamflow stations…
S + AES ABS + AES ABS + PMMA ABS + PMMA ABS + PS ABSS + AES ABS + AES ABS + PMMA ABS + PMMA ABS + PS…
To m because the sequence K2m+1 is bounded in virtueTo m since the sequence K2m+1 is bounded in virtue of (12). There-1 fore, due to the fact we're assuming that…
Ed optimistic virus samples or quantified viral load, and most wereEd good virus samples or quantified viral load, and most were performed just before the Alpha strain appeared. The Alpha…
Ines production . ASMase is essential for cell signaling due to the fact, by way of theInes production . ASMase is vital for cell signaling given that, by way of…
, that is thought of a threat factor for cognitive issues, decreased cognitive, that is regarded a risk issue for cognitive issues, reduced cognitive stimulation, apathy and possibly BMS-8 manufacturer…
Sed must reflect the exploited population . The LBB deliberated stock infoSed need to reflect the exploited population . The LBB deliberated stock info and exploitation status may possibly straight…
And is named a balanced Fmoc-Gly-Gly-OH Autophagy transportation challenge. Otherwise, it really is anAnd is called a balanced transportation problem. Otherwise, it truly is an unbalanced transportation problem. Every unbalanced…
C oxide nanostructures at distinctive growth occasions (three, six, 9, and 12 the The XRDC oxide nanostructures at distinctive development occasions (three, 6, 9, and 12 the The XRD CFT8634…
Vide proof that PA but not NA predicted the subsequent subjectiveVide evidence that PA but not NA predicted the subsequent subjective sleep quality but neither PA nor NA predicted any…
Ofspatiotemporal uncertainty plus the quick pickup and delivery time-windows, the transportingOfspatiotemporal uncertainty and the short pickup and delivery time-windows, the transporting demand which generated by spatiotemporal homogeneity peak passenger flow…
X A, with detailed parameters of the Stirling engine as well as theX A, with detailed parameters of the Stirling engine along with the measuring instruments. Figure 2 shows the…
Irst, nocturnal rodents have a tendency to get additional sleep within the lightIrst, nocturnal rodents tend to get extra sleep inside the light period compared with humans, who sleep in…
Ng subjective sleepiness (Figure 1), no differences have been located for the duration of the eveningNg subjective sleepiness (Figure 1), no variations had been located through the evening in between…
Ban hedgehogs showed no seropositive reactions and no isolation, when 56 ofBan hedgehogs showed no seropositive reactions and no isolation, even though 56 of the 72 hedgehogs captured on dairy…
NA solitary waves inside the CDENPs below consideration, a single has toNA solitary waves in the CDENPs under consideration, a single has to solve the MK-dV Equation (27) numerically by…
Bania, North Macedonia, and Turkey, identify their regions' position in relationBania, North Macedonia, and Turkey, decide their regions' position in relation to EU regions. The originality on the investigation was…
N progress for the reverse cycle. Also, a approach wasN progress for the reverse cycle. Additionally, a method was proposed to predict the indicated operate from the positive Stirling cycles…
Ng subjective sleepiness (Figure 1), no differences had been identified in the course of the eveningNg subjective sleepiness (Figure 1), no variations had been located in the course of the…
Moments of of (c) the number nuclei and (d) the sumMoments of of (c) the number nuclei and (d) the sum with the the capacitive and adsorption currents. The dots…
Thod) blockchain_manager Right after that, Later, an Fmoc-Gly-Gly-OH web authorized of connected nodesThod) blockchain_manager Just after that, Later, an authorized of connected nodes (/peers resource, process `GET'). It element. it…
On the oral-health-related good quality of life (OHRQoL) tool, which include masticationFrom the oral-health-related top quality of life (OHRQoL) tool, for example mastication, phonetics, aesthetics, and basic comfort . A…
The method, the paper. Second, since the PHM is more concernedThe program, the paper. Second, due to the fact the PHM is a lot more concerned with the person overall…
Ergy storage and renewable power systems, but these output characteristics . For that reasonErgy storage and renewable power systems, but these output qualities . For that reason, to improve the…
O implementing diet regime therapy into clinical practice.J. Clin. Med. 2021, ten,12 ofTableO implementing eating plan therapy into clinical practice.J. Clin. Med. 2021, 10,12 ofTable 1. Cont.Bj klund. 2019 5b…
KW of FPV energy generationpower generation unit structure (-Irofulven Inducer Figure buoy TheKW of FPV energy generationpower generation unit structure (Figure buoy The installation from the study is set up…
Ng subjective sleepiness (Figure 1), no variations were found through the eveningNg subjective sleepiness (Figure 1), no variations had been discovered throughout the evening involving the light situations. On the…
Are the ICC duration t1 , t2 . = Is - rs . The BERAre the ICC duration t1 , t2 . = Is - rs . The BER when…
Ofspatiotemporal uncertainty along with the quick pickup and delivery time-windows, the transportingOfspatiotemporal uncertainty and also the quick pickup and delivery time-windows, the transporting demand which generated by spatiotemporal homogeneity peak…
Ed into five categories (zeroth-order, first-order, second-order, third-order, and fourth-order analysisEd into 5 categories (zeroth-order, first-order, second-order, third-order, and fourth-order evaluation solutions). Recently, some models have been developed to accurately…
How ubiquitylation Tianeptine sodium salt Technical Information reactions which are single-encounter substrate and full-length assembled. (BHow ubiquitylation reactions that happen to be single-encounter substrate and full-length assembled. (B) Representative autoradiogramaof…
Statistical approaches. Because of this, new research need to be directed toStatistical methods. For this reason, new studies should really be directed to apply these classification tactics in predicting monetary…
And is named a balanced transportation trouble. Otherwise, it can be anAnd is called a balanced transportation trouble. Otherwise, it 2-Bromo-6-nitrophenol Cancer really is an unbalanced transportation problem. Every unbalanced…
That smokers of more than 20 cigarettes per day were discovered toThat smokers of greater than 20 cigarettes every day were found to have a reasonably greater threat of failure,…
All the filters possess the diameter of five mm and thickness ofAll of the filters possess the diameter of five mm and thickness of 1 mm (Chroma Technology Corporation, Bellows…
- error resulting from a various of- error as a result of a various of complexes, such in addition, it could ,be the results]of a measurement or 2- . Even…
An gland modifications . Beh t's disease CFT8634 supplier ocular attack score 24 (BOSAn gland adjustments . Beh t's illness ocular attack score 24 (BOS24) is usually a novelty scoring…
Dulus and toughness with the PEG-SH/PEG-Mal/Pep hydrogels. Figure SDulus and toughness with the PEG-SH/PEG-Mal/Pep hydrogels. Figure S8: Normalized maximum anxiety for unique hydrogels in 100 compression-relaxation cycles. Figure S9: Swelling…
Jective sleep measures serving as indices for fantastic sleep quality (i.Jective sleep measures serving as indices for great sleep top quality (i.e., sleep onset latency, sleep efficiency, wake time following…
D geometric qualities of your sphere target. The key technical approachD geometric traits on the sphere target. The major technical method on the algorithm is shown in Figure 1. 2.1.…
Cantly enriched terms. 4.five. Analysis of ABA Content material ABA was quantified making use ofCantly enriched terms. 4.five. Analysis of ABA Content material ABA was quantified making use of ultra-high-performance…
These suggestions could be topic to transform as new evidence becomesThese recommendations can be subject to change as new proof becomes available; therefore, the attending doctor ought to have ultimate…
Dy weight one hundred two.6. Skin Pigment and Body Color Evaluation(1) (2) (3) (4) (five) (six)Three fish have beenDy weight 100 2.six. Skin Pigment and Physique Color Evaluation(1) (two) (3)…
Test the framework. Within this context, more verification statistical evaluation willTest the framework. Within this context, more verification statistical analysis is going to be carried out. However, we strategy to…
Ng subjective sleepiness (Figure 1), no differences have been located through the eveningNg subjective sleepiness (Figure 1), no differences have been discovered during the evening in between the light circumstances.…
Orption 20(S)-Hydroxycholesterol References experiment was carried out, as shown in Figure 11. In thisOrption experiment was carried out, as shown in Figure 11. In this experiment, very first, we pre-adsorbed…
Malsgroups exposed to unique a greater expression of might be noticedMalsgroups exposed to unique a larger expression of can be observed that LC consumption in L12 was associated with that…
Chool of Pharmacy, Mashhad University of Healthcare Sciences, Mashhad 1696700, Iran CorrespondenceChool of Pharmacy, Mashhad University of Medical Sciences, Mashhad 1696700, Iran Correspondence: [email protected]; Tel.: +39-075-578-Citation: Bianconi, V.; Mannarino, M.R.;…
. As outlined by the 4.4.1. Solar Panel Theft study, the solar mini-grid effectively. In line with the four.4.1. Solar Panel Theft study, the solar mini-grid IEM-1460 manufacturer successfully electrified…
Ata, as an illustration, comfort preference: 10 a.m., 194 C; schedule: five a.m.Ata, for instance, comfort preference: 10 a.m., 194 C; schedule: five a.m. plus the person seems in the…
Ady to sleep (i.e., in accordance with all the social clockAdy to sleep (i.e., in accordance with all the social clock) and subsequently rated their subjective sleep high-quality improved inside…
L as summarized in Figure two. At the element level, a singleL as summarized in Figure two. In the element level, a single or maybe a set of sensors, for…
All 3 forms of stimulation, whilst 7, 20 and 35 genes appeared to becomeAll 3 kinds of stimulation, when 7, 20 and 35 genes appeared to become particular to a…
FTIR spectra none shows the presence of AlN because it canFTIR spectra none shows the presence of AlN as it can -1 AlN that none of the CA/AlN composites has…
Um hexametaphosphate. 3-Chloro-5-hydroxybenzoic acid manufacturer sample (two.five g) finer than 0.075 mm was dispersed employing sodiumUm hexametaphosphate. sample (two.five g) finer than 0.075 mm was dispersed using sodium hexametaphosphate. The…
Operties of recycled ABS composites containing wood and palmyra fibers. TensileOperties of recycled ABS composites containing wood and palmyra fibers. Tensile and sile and impact properties in the composite samples…
(irrigation commence), the overpressure was reduce reduced and not really considerable.(irrigation commence), the overpressure was decrease reduce and not pretty important.three.3. Configuration and Design and style Proposal The tests carried…
Axm )cCm (d1m dmaxm ) (md1m dmaxm ) c DmAxm )cCm (d1m dmaxm ) (md1m dmaxm ) c Dm (eq j )(5)c Bq (eq j ) (eq j ) sOUTq…
FM4-64 medchemexpress Rystals resulted from DMF CH3 NH3 TEG2 ]PbBr3 , turnover wasfrom theRystals resulted from DMF CH3 NH3 TEG2 ]PbBr3 , turnover wasfrom the precursorpure TEG sysreactive terminal PbBr42-…
CT CTG CAT TAT T. GADPH Streptonigrin web forward primer five -CAT TGA CCTCT CTG CAT TAT T. GADPH forward primer 5 -CAT TGA CCT CAA CTA CAT G-3 ;…
E was printed and additively layered in air and underwater, andE was printed and additively layered in air and underwater, and developed by direct castingand hardened states were compared. The…
AC) and Identification and Authentication (SG.IA) which might be mapped toAC) and Identification and Authentication (SG.IA) which are mapped for the Identity Management and Access Control domain. Only six domains…
Cycle-dependent oscillations in sex hormones have an effect on sleep and cognition . In addition, BakerCycle-dependent oscillations in sex hormones influence sleep and cognition . Also, Baker and Drivers reported…
D for productive sprout inhibition at greater temperatures whereas, for anyD for efficient sprout inhibition at higher temperatures whereas, for any decrease temperature, only one application was adequate to suppress…
S issued a weak recommendation against corticosteroids . Additionally, whilst the very firstS issued a weak recommendation against corticosteroids . In addition, although the initial obtainable case series on COVID-19…
The information and relationships recorded within the ontology at the same time asThe facts and relationships recorded within the ontology as well as those given by the user to the…
Or T9 . It indicates that when the CPE value reaches 5 cmOr T9 . It indicates that when the CPE value reaches 5 cm, then the crop has to…
Igure concentration in every pak choi root showed a positive mentIgure concentration in each and every pak choi root showed a positive ment (0.22 0.01 mg/kg) and Pb 6a). Similarly,…
Of principal elements are set to C 15 15 and 30 for The spatialOf principal components are set to C 15 15 and 30 for The Tasisulam custom synthesis spatial…
Ributions for each IEM-1460 supplier composite electrodes. Having said that, it ought to be spectra showRibutions for each composite electrodes. Having said that, it need to be spectra show equivalent…
The facts and relationships recorded inside the ontology also asThe information and relationships recorded in the ontology also as those offered by the user to the boilerplate. Therefore, specialized recommendations…
eight. Keratin 18, with each other with keratin eight, are expressed in single-layer epithelial tissues ofeight. Keratin 18, with each other with keratin eight, are expressed in single-layer epithelial tissues…
Hich will depend on the pulses or is as : t will be theHich will depend on the pulses or is as : t is definitely the GNE-371 manufacturer duration…
From the FCT and also the FSE, below the POCI system. F.From the FCT as well as the FSE, under the POCI program. F. Coutinho received a analysis contract beneath…
Battery used in this artic BT1200B, whose capacity is 24 AhBattery utilized in this artic BT1200B, whose capacity is 24 Ah, composed of 16 series and 8 parallel co US26650FTC1…
Ersion of the Declaration of Helsinki (2013). 4.two. Process As depicted in FigureErsion of the Declaration of Helsinki (2013). 4.2. Process As depicted in Figure 7, the study covered a…
Ucting a quantitative study of such scenarios, including time considerations. TakingUcting a quantitative study of such scenarios, such as time considerations. Taking all that into account, the contributions of this…
Tpatients with T2DM in central Taiwan to evaluate the impactTpatients with T2DM in central Taiwan to evaluate the effect of statin use on all-cause mortality, plus the benefits also demonstrated…
Diameter for the prototype were about 60 mm and 22 mm, respectively. TekinDiameter for the prototype had been about 60 mm and 22 mm, respectively. Tekin et al. performed a…
Cycle-dependent oscillations in sex hormones affect sleep and cognition . Moreover, BakerCycle-dependent oscillations in sex hormones have an effect on sleep and cognition . On top of that, Baker and…
S are presently released below both the Panperduto Dam as well as theS are currently released below both the Panperduto Dam and also the Langosco Canal intake. However, streamflow usually…
Rotein BMS-986094 supplier concentration ( in dry matter) depending on the therapies (effectively wateredRotein concentration ( in dry matter) depending on the remedies (effectively watered: WW, moderate drought tension: MD,…
Ce, the understanding on how future disturbances, such as climate transform, could have an effect on its sexual reproduction. The aim of this study was to describe for the first…
Nctions. Nevertheless, phenomenological models are usually not physically based, rather, they only adjust the proposed models with a basis on experimental outcomes. Though they're not based on physical phenomena, these…
Ce; Intelligent stochastic simulation models--the most important of that are genetic algorithms and simulated annealing; Evolutionary computing and spatial DNA-- one of the most significant of that are artificial neural…
Uring days six below HP circumstances (Figure 2A) when continuingly decreased beneath LP conditions. The final concentrations of nitrate ( ol L-1 ) UCB-5307 Purity & Documentation inside the four…
Enhancement ratio, permeation flux and drug deposition) had been investigated employing rat skin for comparison against the drug suspension. Lastly, the optimized formulation was evaluated for in vitro anticancer activity…
W the whole history in the material to predict its behavior right after the thermomechanical remedy. Dvorsky et al. investigated the influence of your processing route around the behavior with…
Ng car or truck information: does not show all trips, smaller sample size, instability; for mobile telephone data: missing details might not be compensated, failing to get person attributes Information…
S between cells . You will find potential amyloid core sequences in the post N-terminal domain and C-terminal regions . As for Flo1 and Als adhesins, the ability to kind…
Gence will be the capacity to "relate creatively to worry, discomfort and desire" . Thus, described within a far more extensive manner, this type of intelligence is regarded to become…
Ms Industrial warehouse Service centre TOTAL FIXED Expenses VARIABLE Expenses Engineering and supervision Creating fees Legal charges Administrative fees Contingencies TOTAL VARIABLE Expenses CAPEX Unit Worth one hundred 20 16…
Standard NBC recommendation. The values of RT and background noise levels had been discovered to be higher than those suggested in codes. Poorly insulated classrooms and noise intrusion by way…
E S. leptodictya S. caffra S. galpinii T. sericea V. hebeclada V. karroo V. nilotica subsp. kraussiana V. tortilis Z. mucronata SEaSoluble Phenolics GM-L 0.1011aA 0.0801eA 0.0207jB 0.0788eA 0.0377iB 0.0360iB…
Is of FAUC 365 Formula adherence to HTB-5 cells infected with CFT073fimH, CFT073fimHfliC, and CFT073csgAfimH revealed important differences inside the adherence percentage to these cells (five.24 (p = 0.0001), 6.63…
Ne regeneration, inflammation and pathologic resistance, and implant stability.Author Contributions: E.F.-A. (Eduard Ferr -Amat) in addition to a.A.M. data analysis, outcome assessment, interpretation, and manuscript writing; E.F.-A. (Elvira Ferr -Amat),…
Lly, indicating that the volume fraction of β-Tocopherol Technical Information shrinkage porosity decreases in order. Figure ten shows the DSC curves of alloys, the ratio of endothermic peak height can't…
Lysis, was utilized a Waters Chromatographic system composed of an ultra-performance liquid chromatography (UPLC) model Acquity, coupled with a mass spectrometer. The separation from the compounds was performed on a…
Hermal characteristic parameter. When it comes to constructing energy efficiency, an power efficiency assessment index and its process had been proposed primarily based on time-series simulation, thinking about the specificity…
He majority of the reduced half in the troposphere, the Tmax exhibits Safranin Epigenetic Reader Domain positive sensitivity to measured temperatures, and the opposite inside the upper troposphere. This could…
Nzyme within the case of P and P NC on account of harm caused by the GSK2646264 Cancer fungus (Figure 4F). Concerning APX activity, the highest worth, i.e., 27.41 (…
At sequence. The system made within this function scanned the entire human genome for identification of a particular set of nucleotides (target sequence) and generated well-annotated details as output. This…
Eatures . Some noticeable features will be the absence of linear terms, look of many equilibrium points, and multistability. Most research BI-0115 Inhibitor inside the field of chaotic systems have…
Comparative evaluation of OntoSLAM with other ontologies, it is concluded that this approach outperforms its predecessors in all OQuaRE Excellent Metrics evaluated, with out losing crucial details of Robotics. In…
Olate the constraints were Diversity Library manufacturer termed as "leaders", and were evolved inside the feasible area by the HTS algorithm. By contrast, the violated members have been termed as…
Ientation in between the ligand and receptor, intermolecular interactions and ligand binding which stabilizes the ligandreceptor complex. Molecular docking quantifies the binding energetics and ranks docked compounds depending on binding…
Are listed in in Table 3. volume of dissolved weight corresponds for the for the level of the original material. Thus, in all three circumstances, each of the target material…
Industries. The overview also emphasized several challenges in the printing of these composites that must be solved to boost industry penetration. The printing of metallic supplies permits for the fabrication…
Ls Interior decoration Firestop systems and facilities Boundary walls and partition walls Buildings inside the firefighting district Fire prevention facility upkeep Quantity of evacuation floors Width and quantities of straight…
Trol, frequency, and time synchronization implementations are centralized, stringent latency requirements are imposed on the MFH as explained in Section 8.1 . Consequently, the solution ensures high-layer processing functions centralization…
Enable an interface having a chemical composition similar to one of the base materials, avoiding the formation of phases that will impair the service temperature and with characteristics that market…
Clusion of C2 Ceramide In Vitro experimental and non-experimental investigation to fully realize the phenomenon of concern . Additionally, it allows for combining proof from the theoretical and empirical literature.…
Ned, as well as the possibility of generating hybrid supplies. Thanks to the usage of the sol el method, new materials depending on silicon may be fabricated . The sol…
Ylor (ETPp model and actual Priestley aylor (ETPa model, within the Hargreaves amani (EHH)model, potential Priestley aylor (ETPp ))model and actual Priestley aylor (ETPa ))model, inside the calibration and validation…
Ing to a reduced feeling of attachment to their communities . A vital crucial that affects Arctic youth's attachment to spot can be a well-rooted tradition of upward migration to…
Nt of array gain for compensating wireless communication systems for serious signal attenuation, that is a outcome of penetration loss, path loss, atmospheric absorption, and rain effect. Meanwhile, within a…
Nd methodology on the project. K.S.H.K. and a.M. collected the data, when all authors were accountable for software Fmoc-Gly-Gly-OH custom synthesis program, validation, investigation resources, and information curation. The original…
Igure six). Plant communities at both reference sites have been dominated by forbs with limited to Land 2021, ten, 1191 11 of 17 quasiabsence of mosses and grasses (Figure six).…
E of precise techniques of organization intelligence applied to teaching (for example blockchain ), or improvements in education (some indicated in Table 1). Studies were also identified that refer to…
R PWD proficiently, detecting the early infected pine trees by PWD is of great significance. Even so, it is an arduous assignment to achieve the goal of early monitoring of…
H, CH-8092 Z ich, Switzerland Danish Technological Institute DTI, DK-2630 Taastrup, Denmark; [email protected] Mechanical Engineering Division, Frederick University, Nicosia CY-1036, Cyprus Frederick Study Center, Nicosia CY-1036, Cyprus Correspondence: [email protected]; Tel.:…
Ral side effects . The interaction study between dsDNA and IDA continues to be considerable regarding the suppression of cancer cell growth. To evaluate and IDA continues to be considerable…
Clusion of experimental and non-experimental research to totally have an understanding of the phenomenon of concern . In addition, it allows for combining evidence from the theoretical and empirical literature.…
E the speed in the stroke (conservation of angular momentum) and may very well be an innovative element within the method of topspin forehand. The above is usually regarded as…
Uring days 6 beneath HP conditions (Figure 2A) when continuingly decreased beneath LP circumstances. The final concentrations of nitrate ( ol L-1 ) in the four scenarios were 11.77 2.15…
Tion on the outcome presentation within the form of past/fail isn't complicated if only threshold constant values are known; the difficulty is posed by the unification on the FER vs.…
Es, for instance high temperature, sunlight intensity or UV radiation . Plants respond to drought by means of morphological, physiological and biochemical modulations controlled at the molecular level by hormones,…
The diffusion bonding method. In-between the two OO3 and this MRTX-1719 manufacturer interface layer, it is attainable to observe a thin layer ( 1 ) composed of alternated various grey…
Nure is another amendment used to improve crop productivity in agriculture; it could also benefit plant development on reclaimed tailing storage facilities . The important goal of mine website reclamation…
On impounding facility of hydropower turbine.2.two.1.contrast to the SOP, when the delivering quantity falls amongst zero as well as the demand, In Mass Safranin Autophagy Balance it establishes aimplemented by…
Processes in which these genes may very well be involved, a Set Enrichment Evaluation (GSEA) was was performed in the distinct be involved, a Gene Gene Set Enrichment Analysis (GSEA)…
S and also other hospitals, and the views of urban resident of other hospitals and top-level hospitals cannot be changed. This could be in line with all the anticipated assumptions…
N B1 minimum degree of detection was 0.05 ppb and minimum quantification from regular curve was 1 ppb.Table eight. Biological manage mono and co-culture experimental design and style. Cultured Isolates…
Nd RSE. Compared with a model with a single output, a model with two or a lot more output variables (such as PM2.five and PM10 concentrations) has the advantage that…
Esquiterpenes, caffeic acid, luteolin, rosmarinic acid, hispidulin, flavomonoterpenes, sesquiterpenes, caffeic acid, luteolin, rosmarinic acid, hispidulin, JNJ-42253432 Biological Activity flavonoids, noids, oleanolic acid (OA) and ursolic acid (UA) . is usually…
Y they Olesoxime Cancer derived Equation (13):0 2200 0 -1 45 three tan200 tan111 =- 2(13)The requirement to possess strain-free alloys for the identical composition was overcome by PF-06454589 Epigenetic…
Clusion of experimental and non-experimental investigation to completely understand the phenomenon of concern . In addition, it makes it possible for for combining proof from the PF-06873600 Epigenetics theoretical and…
T We have in kinds of Hz is obmeasurement in last line representedwe Table 1.table. properties presented prior to are of this The eigenfrequency The eigenmodes are of in Table…
Rhamnopyranosyl-3hydroxydecanoyl-3-hydroxydecanoate). The ratio of dirhamnolipid to monorhamnolipid varied, as proven in Table two. Crude rhamnolipid developed from FAME had a greater ratio of three.22:1 in comparison with crude rhamnolipid generated…
Nd fluorescence spectroscopic information revealed formation of the DABCO/ZnP complicated together with the expected 1:2 ratio, thereby confirming the anticipated transformation of rotaxane 18 into 20. PHA-543613 manufacturer Time-resolved transient…
Cture (HCP). Particularly, titanium and its alloys are broadly applied in aerospace, aircraft and also the healthcare sector ; zirconium is employed within the nuclear market and Mg-based alloys within…
Sorts of studies and have the potential to enhance innovations. In the very same time, such policies really need to be assessed by means of the lenses of confidentiality and…
Inally kind RNA in prebiotic situations . The same group also reports the formation of numerous aliphatic acids and hydroxy acids by heating formamide (Z)-Semaxanib Protein Tyrosine Kinase/RTK inside the…
D collection, PON-based option is susceptible to energy loss and latency . This additional lowers the cell radius and brings regarding the difficulty in fault isolation . A variety of…
Deformation. Different models of phenomenological constitutive equations had been tested to verify the effectiveness of flow anxiety prediction. The pressure exponent n, derived from the strain-compensated Arrhenius-type constitutive model, presented…
S as well as other hospitals, and also the views of urban resident of other Nimbolide Apoptosis hospitals and top-level hospitals can't be changed. This can be in line together…
Inferred thatof 24 12 the frequency of summer daytime and nighttime has been rising for the previous 33 years.Figure five. The seasonal trend magnitudes of heat and cold duration indices…
S may be obtained from corresponding author. Acknowledgments: The authors would prefer to acknowledge all the interviewees who kindly donated their worthwhile time for you to help develop the survey,…
Ss; and (c) dimensional specifics of unit cells.Appl. Sci. 2021, 11,Within a equivalent style, two 3D Benidipine Technical Information samples with identical geometrical capabilities have been fabricated by indicates of…
Cture (HCP). Particularly, titanium and its alloys are extensively utilized in aerospace, aircraft and also the health-related business ; zirconium is utilised within the nuclear sector and Mg-based alloys -Irofulven…
It was outside inside the outer city region the thirdmore road than distance costs.from the third ring road. In the perspectives of your times and distances of emergencies from the…
E water is routed to storage. These calculations applied to all GRxJ models. More particulars with the models' configuration may be located in .PHA-543613 Purity & Documentation Figure 3. GR4J…
R, several pieces of of investigation located within the literature have shown qualities. On the other hand, many piecesresearch located in the literature have shown that excessive inclusion of conductive…
Is extremely Bafilomycin C1 Cancer proposed for your stakeholder representing governments to improve the employs of CWs. The agricultural schemes use fertilizers (phosphate), and an excess volume of these fertilizers…
Ions. Tablethe EDS benefits ofresults with the zones on the SEMthe SEM of PX-478 Autophagy,HIF/HIF Prolyl-Hydroxylase Figure six. The identification of the possible attainable phase(s) was performed by combining the…
Lities. Right after Beijing, Wuhan became the second city in China which will situation internationally recognized trauma initially help Tianeptine sodium salt Protocol qualification certificates. Wuhan has a quantity of…
Created by Jenkins and Watts (1968), Box and Jenkins (1976), and Mangin (1984) . It was utilized for the identification of basic traits of karst underground, like study on hydrodynamics…
Elsewhere (e.g., ). The contour levels in Figure six were evaluated for various stalk heights by parameterizing the stalk dielectric constant st with gravimetric moisture m g making use of…
Proach is incorporated in Scheme two, treated with aniline (17) to ple of this approach should be to aldehyde 20 (G = CHO), which in turn is condensed with methyl…
Be attributed for the biological legacies of fires (surviving trees, snags, logs, patches of intact vegetation, seed banks in tree crowns, or the soil), which result in the development of…
Obtained from each and every strain price. Afterward, the . imply value of A might be obtained in the intercept of vs. ln plot, which was calculated to be 3742…
Following sections, some considerations about daylight, its interaction with urban groves (a crucial element in cities) as well as the final results of a measures campaign to study this interaction…
The everyday soil moisture content were drastically correlated with open burning. The results of this study boost our capability to forecast agricultural fires and present a scientific framework for regional…
Acterial strains from the consortium that assisted in the metabolic process of natural current while in the industrial industrial effluent. The adapted consorof natural compounds compounds current in theeffluent. The…
Applied to decide constitutive constants and create a processing map in the total Fmoc-Gly-Gly-OH site strain of 0.8. In the curves for the samples deformed at the strain rate of…
Igure six). Plant communities at both MCC950 MedChemExpress reference websites have been dominated by forbs with limited to Land 2021, ten, 1191 11 of 17 quasiabsence of mosses and grasses…
E whole bridge.Author Contributions: Conceptualization, W.W.; investigation, W.W.; validation, M.S., W.W.; writing--original draft preparation, W.W.; writing--review and editing, M.S., W.W. All authors have read and agreed for the published version…
E the variations inside the technical ability performances amongst competitions. As players would have performed five months of technical talent practice before the Championship, their skills might have been a…
Of 0.04 s-1. Figure six shows working with a universal uniaxial compression tester having a strain rate of 0.04 s-1 . Figure 6 shows the experimental setup for the compression…
At concentrations close for the solubility limit, it is actually energetically favorable that the atoms inside the solution remain close to every other. Precipitation will only take place in the…
Y patients inside the city, substantially larger than the amount of sufferers accepted by Tongji Compound 48/80 supplier hospital and Union Hospital. This sort of regional healthcare stress should be…
O been reported that high-pressure application and room-temperature deformation stabilizes the omega phase below specific circumstances . The information described above are discussed inside the literature. However, the omega phase…
Y sensing systems, citizen science projects, points of interest (POI), volunteered geographic data (VGI), net use, e.g., search engine information, mobile phone data (MPD), GPS log data from handheld GPS…
A strong medium is shown in Figure 1c. BaTiO3 microspheres having a refractive index of 1.9 have been self-assembled and distributed on liquid polydimethylsiloxane (PDMS). Just after drying as well…
All target of this project. 4.two. Investigation Question 1: Existing Challenges for Teachers inside the Qatar Education Program (QES) The findings within this subsection corresponding for the investigation question of…
D. In addition, the neighborhood transit agency, the Shenzhen Metro Business (SZMC), acted as a pivotal stakeholder: around the 1 hand, the SZMC represented the Shenzhen municipality, contributing to 27.43…
W the entire history of the material to predict its behavior soon after the thermomechanical remedy. Dvorsky et al. investigated the influence with the processing route around the behavior of…
Y individuals in the city, a great deal higher than the amount of patients accepted by Tongji Hospital and Union Hospital. This type of regional medical pressure needs to be…
E 37 research working with satellites ("satellite only" and "satellite other" in Figure 2). Please note that some studies use information from more than 1 satellite. From this evaluation, WorldView…
N a heat block at 60 C for 1 h . Total genomic DNA was isolated using MonarchGenomic DNA Purification Kit (New England Biolabs, Australia). A blank isolation with no…
Arly phases, if sustainable development objectives are to be accomplished . In the circular economy, production and consumption are intertwined in an effort to cut down pollution. Since its conception,…
Onclusions, limitations on the study, and future researchReferences 2. Components and Methods The main objective of this project may be the generation of numerical models that permit an individual interested…
Tribution of study. The literature supplies optimization models that can be employed within the distribution with the humanitarian provide chain; on the other hand,in Mexico, it really is critical that,…
Showed three aromatic L-Kynurenine Autophagy protons at H 6.83, 7.21 and 7.46 ppm: a phenolic OH at H four.88 ppm and aromatic methoxy at H 3.90 ppm. A de-shielded methyl…
From the hypertrophic markers Nppa and Nppb (Figure 3F,G). As SH3BGR seems to hamper SRF activity, we investigated its effects on SRF downstream signaling. In addition, we also observed significant…
The first-time cows were bred and conception was the very first optimistic scan corresponding to a service date. The fertility measurements evaluated have been days from calving to 1st service…
Rried out. r: discount price. For EPC type photovoltaic installations, it really is advisable to use six . n: useful life on the plant: It really is Casopitant Epigenetic Reader…
Ion d0 . . . ( k 1) d k = r - s .Homogeneous Function Theorem. Let Ei iN be finite-dimensional vector spaces. Let f : i=1 Ei R…
A/Dieta del gruppo sanguigno (Ketogenic diet/Blood group diet regime) Dieta del riso /Dieta colesterolo /Dieta a zona ^/Dieta settimanale (Rice diet program)/Cholesterol diet/Zone eating plan ^/Weekly diet Colesterolo Cholesterol ^…
E in intercellular adhesion amongst pancreatic acini and/or endothelial cells . One of the essential regulators in acute Coumarin-SAHA Data Sheet pancreatitis is oxidative anxiety. It promotes the expression of…
Payback period was identified to become 1.01 years, which shows that the replacement of HPS lamps with LED lamps is an economically eye-catching selection. Frequently, projects having a payback of…
Ry to calculate the number of modules within the installation, by means of the equation: Nmodule = Peak Power STC Module Power (20)The Equation developed that allows estimating the sale…
E range of actors like neighborhood residents, regional government, environmental groups, and small Hydrocortisone hemisuccinate Inhibitor business entities . To this end, accurate and fair info must be provided to…
Or maybe a heterogeneous group of progressive illnesses with structural and functional dysfunctions with the heart, ordinarily with improper ventricular hypertrophy or dilatation. You'll find 4 main forms, but dilated…
He terms section involves definitions of some frequent cybersecurity terms, such as Ethical Hacking, SocialEngineering, Two-Factor Authentication, Honeypot, Firewall, Ethical Hacking, Social Engineering, Two-Factor Authentication, Honeypot, Firewall, Rootkit, Worm, Trojan,…
Improvement of your Swiss-Uzbek healthcare consortium. The authors express sincere gratitude to the MEDLINE Clinic in Urgench (Uzbekistan) and the Urgench branch of Tashkent Health-related Academy for supplying the essential…
Ties . Agresta et al. demonstrated that athletes with compensation/imperfection throughout the rotatory stability FMS activity present decreased control on the trunk, pelvis, and hip muscles. A evaluation on the…
Rties as a result of high as 0.eight Tm, exactly where Tm is definitely the melting temperature); the price of alternating shouldstrain is shear be grain growth for the duration…
In elevated depolarization by effluent 66.7, living tissues like skin, mucosa, and wounds, pepissue . Hospital66.three, 68.four,water,67.8, and 75.six , respectively, suggesting that theseand tides target the CRAB as urinary…
N from using raw fossil materials, the contribution of renewable power generation forms will continue to grow stronger . Study shows that the usage of fossil fuels to receive energy…
Of each and every compound within the chromatogram . 2.three. GC-MS Compounds in CS and Screening of DLCs The chemical constituents in CS have been detected by means of GC-MS…
N based on the obtained mass adjust curves have been as a result pretty general. It was found that up to approximately 1500 h, the mass obtain recorded for the…
Cation The PDMS capabilities fabricated by soft-lithography had been bonded on the surface in the MEA substrates to define the cell patterns along with the bridges amongst clusters of cardiac…
Out which was additional than when the sample was given 28 days was provided 28 days to remedy, seven timesabout seventhe times more than the soil just before remedy.soil prior…
Flammatory disease generally caused by bacterial infections. Inside the present study, we identified the ruminal microbial biomarkers and metabolites of mastitis in dairy cows. The investigation of the reciprocal interrelationships…
Hy (Centre, North, and South from the Iberian Peninsula, and the Canary Islands) will probably be studied. This can allow the generation of a database of costs and production that…
OsticsDiagnostics 2021, 11,two ofsection, n = 7 things in the "Imaging Protocol" section, and n = 18 items in the "Report" section. All round, 52 items were integrated in the…
And 9. Handle,Manage, cells without having treatto differentiation and morphological alterations had been documented on days five, days five, 7, and 9. cells with no treatment; E2, ment; E2, Ros,…
Mate the cumulative measure of genetic threat identified by means of genetic Association studies, PRSs aggregate person variants to improved measure of the genetic predisposition for any polygenic health outcome…
Eeds to NADPH tetrasodium salt Purity & Documentation assess the efficiency distinction in between athletes. To what extent the running energetics, especially near the LTAn intensity, differ between athletes, and…
Documented the interventions that had been performed. Intervention types (suggestions) integrated within the checklist had been 72-h critique (to follow for culture and sensitivity), antibiotic modify, escalation, de-escalation, discontinuing therapy,…
C challenges athletes face . Mindfulness is both a trait plus a state, characterised by non-judgmental awareness and consideration to present moment thoughts, feelings, and feelings . People with higher…
Of vaccines RQ4. Who're the actors involved inside the supply chain of C2 Ceramide Inhibitor vaccine distribution in Mexico RQ5. Is there a methodology for the style of the provide…
Isdictional claims in published maps and institutional affiliations.Abstract: In this paper we examined the interaction between greenhouse gas emissions, nuclear energy, coal power, urban agglomeration, and financial growth in Pakistan…
E space amongst rows of modules. Figure five shows the percentage of installable energy more than the maximum, with 100 getting the maximum installable power for a 10 inclination. The…
Ation and severity of IBD, the comprehensive colon coverage by the illness, as well as the presence of primary sclerosing cholangitis . The maximum threat of developing colon cancer in…
Reported in these research , further analysis is necessary to determine the optimal variety, concentration, and infusion rate of LA. In one particular study, ropivacaine concentration exceeded the security threshold…
Filiations.Copyright: 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access short article distributed beneath the terms and situations in the Creative Commons Attribution (CC BY)…
That 0.03 8, and it could possibly be concluded that the hypothesis concerning the equality of averages was canceled. This means that the outcomes differed (Figure 7).Figure six. Pilling marks…
Ously, neutrophils altered the cell adhesion potential upon remedy with antiGPI-80 mAb (3H9) . As described above, PC3 cells seemed to be superior than other cell lines for investigating the…
Rophils . Because the important pathological change in liver damage brought on by APAP is oxidative pressure, it is significant to uncover antioxidants which can be efficient in alleviating hepatotoxicity…
Overexpression has been shown to promote fibrogenesis in hepatic stellate cells .Int. J. Mol. Sci. 2021, 22,13 ofHowever, further investigations are required to study the function of LIMK1 in the…
Lated with an Excel sheet, as shown in Table 5. In Table 5, A = 1, B = 346.86, and C = 30,121.742. The discounted payback period is calculated making…
Ry to calculate the amount of modules within the installation, by way of the equation: Nmodule = Peak Energy STC Module Energy (20)The equation created that makes it possible for…
Scan-path delivers a worthwhile process to -Irofulven supplier investigate how a task forces the topic to keep a top-down (human intention) internal representation on the visual scene in the course…
Ctive function E2 , whichis shown in Equation (15). Fp (i) = E2 =1 ^ (15) Fp (i)=E2= ( P(i) - P(i,))2 In Equations (14) and (15), I represents ithe…
Larger prices of cognitive impairment (68.five vs. 40.1 , p 0.001), depression (48.1 vs. 25.5 , p = 0.003), and BADL disability (51.six vs. 32.8 , p 0.001). 2.1. Outcome…
Study. This area was divided into 3 blocks to balance for soil fertility and sward age. The blocks had been additional subdivided into 4 equal Solvent violet 9 In Vivo…
Rried out. r: discount rate. For EPC sort photovoltaic installations, it can be suggested to utilize 6 . n: valuable life of the plant: It really is recommended to use…
L protein, myosin-II-like (non-muscle) (151 kDa), was discovered within the sample and is thought to be active through the mitosis and invagination of eggs for the duration of Drosophila embryogenesis…
To five (5 being by far the most complicated program) primarily based on the quantity of sensors the systems utilized. To evaluate portability, scores had been assigned to papers primarily…
Calculation variables, for which present values are proposed if they are unknown. The evaluation with the LCOE may be simplified to a single analytical calculation, which in turn implies a…
Teraction Research Group of Sun Yat-sen University) in the zonal statistics as a table tool of ArcGIS10.7 (Esri, Redlands, CA, USA). The place variables were calculated primarily based on Anhui's…
Odels. For many domains, precise and curated data does not exist. In these scenarios, slightly unconventional however incredibly successful approaches of producing data from published scientific literature and patents for…
Nd-to-end PCR for detecting no matter if all plastomes are in transformed state. The system has been applied previously for investigating that all plastid genomes are in transformed state and…
Ud-constructed Delaunay triangle meshes can derive inactive triangulation , features extraction of point cloud data from point cloud Voronoi diagrams with unique geometrical shapes of plates, spheres, and rods ;…
Metabolism and osteoblast and osteoclast activity varied with age in DK and FK hens (with far more variation in FK hens) in comparison with the NK hens. Additionally, as reflected…
Ting day,days of of consecutive soccer coaching, andone postconsisting pre-training testing day, five five days consecutive soccer coaching, and a single posttraining testing day. Intervention weeks have been scheduled in…
Onclusions, limitations from the study, and future researchReferences two. Supplies and Strategies The primary objective of this project would be the generation of numerical models that enable a person considering…
Not have any affordable criteria to assign the relative significance of every single KPIi , in this perform, as a initially approximation, all Si have the similar relative relevance and,…
D blast furnace slag (GBFS) and sodium silicate (SS) as surface modifiers. The GBFS-slurry-impregnated coral aggregate can proficiently physically block the pores of coral aggregate, effectively lower the water absorption…
T of skeletal muscles along with the formation of multinucleated osteoclasts. The latter are vital for bone N-Acetylornithine-d2 In Vitro resorption and are generated by the fusion of macrophages. However,…
He value 2 L, where will be the fluid viscosity, will be the rotation price, R is definitely the helical radius, and L is definitely the axial length. The optimized…
Ck young children, purposively selected from 30 facilities, until information saturation was achieved. The challenges discussed incorporated the course of action of referral, challenges in referral completion and solutions to…
Lume stability of CMM0.5. f-CaO H2 O = Ca(OH)(two)Figure 9. The expansion prices of CMM-12 h and CMM0.five at unique autoclaved times.Table 4. CMM autoclaved test parameters.Figure 9. The expansion…
Num majorana (winter thyme)Satureja hortensis (summer thyme), Thymus vulgaris (thyme), and Satureja montana ram), . Carvacrol has lengthy been recognized as a component of oregano important oil, getting thyme)its most…
Se direct medication price for the individuals . Even so, savings of far more than USD 900 had been achieved on antibiotics inside a study involving an ID doctor, a…
Payback period was found to be 1.01 years, which shows that the replacement of HPS lamps with LED lamps is definitely an economically eye-catching selection. Typically, projects with a payback…
Lation level involving FE simulations and field tests is usually a essential aspect in improving the time- and cost-efficiency of numerous engineering projects. In specific, it really is essential in…
O additional studies in animals . In the present study, we identified the CLU gene as amongst essentially the most VK-II-36 Purity & Documentation severely deregulated genes through wound Tamsulosin-d4…
Alizarin complexone Autophagy transfer coefficient is affected by two important aspects, which are the cohesive forces along with the molecular momentum transfer, each of which are temperature-dependent. In fluids, a…
Ach of your studied places. Figure 7. Yield as a function of Abscisic acid Purity & Documentation inclination for every in the studied areas.The The maximum production is discovered in…
Utilized (Samuel Barber's Adagio for strings in B minor in the 2nd movement of String Quartet, Op. 11). As for the diatribe between the focus and memory-based models, it is…
Nner, outer) = (130, 40)(inner, outer) = (130, 50) accX accY accZ -0.0615 0.0199 0.0923 0.4981 0.2654 0.accX accY accZ 0.0024 0.0182 0.0936 mean 0.4997 0.2667 0.2713 SDaccX accY accZ…
Onclusions, limitations of the study, and future researchReferences 2. Materials and Approaches The main objective of this project is the generation of numerical models that allow an individual thinking about…
H was higher for WCO biodiesel compared with diesel. The spray angle becoming narrower with a larger density, WCO biodiesel has a negative air-fuel mixture, which makes it possible to…
Ensor flow or CNTK. Caffe's most significant bragging correct is its speed. Nevertheless, often it may need usage of low-level language, which numerous customers don't like. Caffe can also be…
Ls and goods, particularly inside the exact same urban agglomeration. Meanwhile trade facilitates the optimization of resource allocations under scarcity, amongst cities and sectors, and therefore generates financial gains. This…
Percentage for each the very first (PC1) and second component (PC2). The first two PCs accounted for greater than 80 in the variance. To identify the possible use with the…
Controlbined with Figures ten and 11, it might be noticed that the improved handle tactic Combined with Figures ten and 11, it may be seen that the improved handle method…
Rried out. r: discount price. For EPC variety photovoltaic installations, it's suggested to make use of six . n: helpful life of the plant: It really is encouraged to use…
Which are in pathways regulated by Angiotensin I Converting Enzyme (ACE), Angiotensin II Receptor Form 1a (Agtr1a), and Bradykinin Receptor B2 (Bdkrb2) (see Table eight and Figure three). In each…
Prings' power could be forc rebounded to a different small amplitude of drop to -0.15 mm. Therefore, the top rated magnet holder would0.2 mm/the lowest amplitude of -0.four mm. In…
S a studied studied websites: Cy5-DBCO Epigenetic Reader Domain Figure 6 shows for GHI for each of theproportional enhance inside the maximum installable energy due to the fact proportionally additional…
State with the neighboring UAVs and routes the considers the congestion state in the neighboring UAVs and routes the packet to a UAV packet to a UAV that moves closer…
Ide the film. The sensor was tested in MES buffer andIde the film. The sensor was tested in MES buffer and synthetic urine; in this context, the results obtained had…
Cytokines (IL-4 and five) within the spleen though escalating anti-allergic form 1 (IFN) and regulatory (IL-10) cytokines. The group then demonstrated that their nanoparticles diffused by way of pig intestinal…
Of Kind 2 Diabetes in Rats T2DM was instigated in overnightOf Sort two Diabetes in Rats T2DM was instigated in overnight starving rats with an intraperitoneal (i.p) injection of streptozotocin…
Grounds are affected by temperature and humidity modifications for an undetermined time--hence the risk of JPH203 Purity & Documentation infection really should be reduced than in the hospital atmosphere. Survival…
Brera 1 , Beatriz Zeifert two , Tamara V quez 2 , JosSalmones two and Miguel Angel Guti rez-LimDepartment of Power, CBI, Metropolitan Autonomous University-Azcapotzalco, Av. San Pablo 180, Col.…
Of NaCl) on microbial antagonism of R. calopus against Sclerotinia sclerotiorum.Of NaCl) on microbial antagonism of R. calopus against Sclerotinia sclerotiorum. High salt concentrations drastically lowered the amount of microsclerotia…
Preparation, R.B. and M.Z.H.; writing--review and editing R.B. and M.Z.H.; visualization, R.B.; supervision, M.Z.H., Z.Z. plus a.H.A.; project administration, M.Z.H.; funding acquisition, M.Z.H. All authors have study and agreed for…
3-DAP in the concentration array of 0.5 mM led to a gradual3-DAP within the concentration array of 0.5 mM led to a gradual disappearance of heterogeneity within the colony size…
Viding illumination. The lights are nearly constantly off inside the Kronprinzenappartements as these rooms are hardly ever applied. During the COVID-19 lockdown, lights had been normally also off throughout the…
Duced OMVs . They are generated because of heat-induced modifications between the outer and inner membrane layers, triggering the release of these vesicles. Their composition with regards to the cytosolic…
Rature one by one. The temperature measured against the spectrum isRature one by one. The temperature measured against the spectrum is then made use of in conjunction with all the…
Cular cerebrospinal fluid white matterpharmaceuticsReviewTargeting the Gut Mucosal Immune Technique Working with NanomaterialsJacob McCright , Ann Ramirez , Mayowa Amosu, Arnav Sinha, Amanda Bogseth and Katharina Maisel Fischell Department of…
The bioavailability radar plots (Figure 9). This demonstrated that the bioavailability radarThe bioavailability radar plots (Figure 9). This demonstrated that the bioavailability radar for each of the brominated indoles Methyclothiazide…
And (e) Pt25SA4W. The graphic of theof the H2 consumption the TPR (up to 500 ) of C) (d) Pt25SAW, and (e) Pt25SAW. The graphic H2 consumption from in the…
Ous solutions, far significantly less than the equivalent level of PE (one hundred mg) Michigan (LM) water. (HCs = hydrocarbons). used in our 18 mL aqueous options. The solutions collected…
Other hand, the wound is filled withshowedclots,pattern, extravasateddeepest part ofOther hand, the wound is filled withshowedclots,pattern, extravasateddeepest part in the wound, FigureinThe striated musclean abnormal Gamma-glutamylcysteine custom synthesis sloughed Chlorfenapyr…
In regions are represented in Table three, highlighting the wasventricle Volume correlated left nucleus accumbens (p = 0.0240), proper cerebellum white matter volume (p (p = 0.0422), brain regions are…
He MGN was subjected to molecular Cloperastine hydrochloride docking research using the homologyHe MGN was subjected to molecular docking research making use of the homology modeled structure from the yeast…
Ank (PDB); 3A4A. Just after effective re-docking results, MOE was employedAnk (PDB); 3A4A. Right after prosperous re-docking results, MOE was applied to establish the binding mode on the MGN. The…
Patch or other M-cell-rich regions . The authors regions . The authors particularly tested 95, 110, 130, 200, and 340 nm nanoparticles specifically tested 95, 110, 130, 200, and 340…
Penetration decreases) for periods of weeks and months, and that thisPenetration decreases) for periods of weeks and months, and that this was independent of oxidative hardening as reheating the sample…
Oils have shown a high oxidative stability and antioxidant properties . This could be due to their high contents of unsaturated fatty acids, sterols, and -tocopherols, and phenolic compounds. The…
All phases all phases instantaneously, overriding the phase-shedding function. transienttransient is enhanced with 2time response and and also a reduced safesafe overcurrent technique is improved only a 2 a ms…
Model hyperparameter no Acquisition of YM-26734 Technical Information Information Data preprocessing Correlation analysis Division of dataset Train the TCN model Is accuracy sufficient yes Save pretrained model Test dataset Test…
InatescentralThe dashed lines indicatethe Mosliciguat site wild-type enzyme. Enzymes using a bettertios. TheInatescentralThe dashed lines indicatethe wild-type enzyme. Enzymes using a bettertios. The centralover the central diagonalthe wild-type enzyme. Enzymes…
Ore, it is actually critical to elucidate the mechanism of wheat starch synthesis in response to drought and high-temperature pressure during the grain filling period. In current years, lots of…
Regional modifications in storm frequency are substantially diverse than what theyRegional alterations in storm frequency are substantially various than what they are Diflucortolone valerate Cancer globally. Indeed, substantial ACE and…
Or topological relationships between objects . OBIA is regarded as an efficient and effective technologies for VHR image classification as a consequence of its clear and intuitive technical approach .…
Ure three displays an instance of RF. RL algorithms could be categorized to value-based (e.g., Q-learning, SARSA) and policy-based algorithms (e.g., NBQX disodium iGluR Policy Gradient (PG), Proximal Policy Optimization…
Gnificant reduction in DC levels in Raji cells soon after EBV lytic cycle induction (p (p 0.05) (Figure five). 0.05) (Figure five).Figure 5. Conjugated diene levels determination on Raji cells…
3-DAP inside the concentration range of 0.5 mM led to a gradual3-DAP within the concentration selection of 0.five mM led to a gradual disappearance of heterogeneity within the colony size…
Osphatase that is certainly abundantly expressed in all nucleated cells of hematopoietic origin (constituting about 10 of your total surface proteins) . It has been shown that CD45 activity is…
.89 3.10 3.42 3.70 two.85 3.16 three.60 three.44 four.19 4.47 4.09 4.19 4.ten four.28 three.83 3.87 4.KI-Ketoamide inhibitor-8.1.Taxifolin-6.1.2 3Pectolinarigenin Tangeretin Gardenin B-5.74 -6.61 -6.48 -5.1.72 1.17 0.aHispidulin.89 three.10 3.42 3.70…
S C at baseline.The basic follow-up visits schedule calls for up to 3 months to figure out if the patient was infected with HIV. The exceptional case of acquiring HCV…
Ailand, and Sri Lanka. The fleshy fruit of P. pinnata isAiland, and Sri Lanka. The fleshy fruit of P. pinnata is edible and valued as a classic medicine for the…
three.48 1.3b ParameterBW, physique weight; N, regular diet plan (n = 12); HF, high-fat eating plan3.48 1.3b ParameterBW, body weight; N, typical diet program (n = 12); HF, high-fat diet…